Incidental Mutation 'R1740:Cds2'
ID200258
Institutional Source Beutler Lab
Gene Symbol Cds2
Ensembl Gene ENSMUSG00000058793
Gene NameCDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
Synonyms5730460C18Rik, 5730450N06Rik, D2Wsu127e
MMRRC Submission 039772-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1740 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location132263148-132312050 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 132302213 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 320 (I320N)
Ref Sequence ENSEMBL: ENSMUSP00000099470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089461] [ENSMUST00000103181] [ENSMUST00000147456]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089461
AA Change: I303N

PolyPhen 2 Score 0.470 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000086886
Gene: ENSMUSG00000058793
AA Change: I303N

DomainStartEndE-ValueType
Pfam:CTP_transf_1 52 382 5e-90 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103181
AA Change: I320N

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099470
Gene: ENSMUSG00000058793
AA Change: I320N

DomainStartEndE-ValueType
Pfam:CTP_transf_1 69 399 7.6e-90 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000138194
AA Change: I46N
SMART Domains Protein: ENSMUSP00000121769
Gene: ENSMUSG00000058793
AA Change: I46N

DomainStartEndE-ValueType
Pfam:CTP_transf_1 3 126 8.7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147456
Meta Mutation Damage Score 0.31 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Breakdown products of phosphoinositides are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. This gene encodes an enzyme which regulates the amount of phosphatidylinositol available for signaling by catalyzing the conversion of phosphatidic acid to CDP-diacylglycerol. This enzyme is an integral membrane protein localized to two subcellular domains, the matrix side of the inner mitochondrial membrane where it is thought to be involved in the synthesis of phosphatidylglycerol and cardiolipin and the cytoplasmic side of the endoplasmic reticulum where it functions in phosphatidylinositol biosynthesis. Two genes encoding this enzyme have been identified in humans, one mapping to human chromosome 4q21 and a second to 20p13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. Heterozygotes show a distorted lymphocyte distribution and enhanced sensorimotor gating. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,125 C417* probably null Het
4930548G14Rik G A 15: 46,625,489 noncoding transcript Het
Abcc12 T A 8: 86,505,497 K1311* probably null Het
Abcc12 T C 8: 86,509,771 D1138G possibly damaging Het
Adam32 A G 8: 24,921,298 S116P probably damaging Het
Arhgef26 C T 3: 62,423,583 L39F probably damaging Het
Babam1 T C 8: 71,403,019 I252T probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Ccdc109b A T 3: 129,918,727 H166Q probably benign Het
Ccdc61 G T 7: 18,903,937 probably benign Het
Ccdc89 C T 7: 90,426,738 S52F probably damaging Het
Cebpe T C 14: 54,711,942 Y6C probably damaging Het
Cep250 T A 2: 155,973,356 I598N probably damaging Het
Cep350 T A 1: 155,928,833 I835F probably damaging Het
Ces3a T C 8: 105,048,685 L22P probably damaging Het
Cfap221 T C 1: 119,945,828 S490G probably benign Het
Cyp2j11 A G 4: 96,319,376 V234A probably benign Het
Dgat1 T C 15: 76,502,729 H399R probably damaging Het
Dnah10 A T 5: 124,773,190 probably null Het
Ebpl T G 14: 61,341,207 K193T probably benign Het
Elmsan1 T C 12: 84,172,902 E426G probably damaging Het
Entpd5 T C 12: 84,396,771 N66S probably benign Het
Fcgbp G T 7: 28,101,249 G1240V possibly damaging Het
Gabra5 A G 7: 57,421,842 S209P probably benign Het
Glce A T 9: 62,070,533 V23D probably damaging Het
Gm14226 GACTGTTAC GAC 2: 155,024,931 probably benign Het
Gtf2h1 A G 7: 46,812,466 N296S probably null Het
Herc6 T C 6: 57,652,065 S654P probably benign Het
Kcnk3 A T 5: 30,621,977 M124L possibly damaging Het
Lamb2 T G 9: 108,481,928 V281G probably damaging Het
Lctl A T 9: 64,133,107 D444V probably damaging Het
Mcm2 A G 6: 88,884,044 F891L probably damaging Het
Mical2 G T 7: 112,333,836 R739L probably benign Het
Mkrn2 G T 6: 115,613,369 A229S probably damaging Het
Mmp7 A G 9: 7,695,277 Y80C possibly damaging Het
Mpp2 T C 11: 102,062,396 probably null Het
Msh6 C A 17: 87,985,722 T635K possibly damaging Het
Mvd T A 8: 122,436,547 T315S probably benign Het
Myocd C T 11: 65,218,521 probably benign Het
Nav1 C T 1: 135,458,389 probably null Het
Olfr1298 T A 2: 111,645,869 I43F probably damaging Het
Pde4b A T 4: 102,487,351 D141V probably damaging Het
Pdgfrb A T 18: 61,081,833 D978V possibly damaging Het
Prss55 T C 14: 64,075,680 T252A probably damaging Het
Psd3 A T 8: 68,120,839 V230E probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptprn A G 1: 75,262,050 V82A probably damaging Het
Ptpru G T 4: 131,793,678 probably null Het
Raph1 T A 1: 60,519,024 K258* probably null Het
Rnf25 A G 1: 74,598,727 V28A probably damaging Het
Slc25a4 C T 8: 46,208,503 V212M probably benign Het
Slc39a3 T C 10: 81,031,508 S135G probably damaging Het
Slco6d1 A G 1: 98,428,372 I220M probably damaging Het
Smim19 G T 8: 22,473,528 Y21* probably null Het
Speer4f1 A C 5: 17,478,761 Y141S probably damaging Het
Srgap2 G A 1: 131,289,388 P1062L probably benign Het
Stra8 A T 6: 34,927,719 probably benign Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem40 A G 6: 115,738,999 S76P probably benign Het
Unc13b C T 4: 43,240,285 R3569W probably damaging Het
Vmn1r128 A T 7: 21,349,944 Q191L probably benign Het
Washc2 T A 6: 116,231,632 probably benign Het
Other mutations in Cds2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cds2 APN 2 132297293 missense probably damaging 1.00
IGL00434:Cds2 APN 2 132293351 missense probably damaging 0.99
IGL00771:Cds2 APN 2 132304352 splice site probably benign
IGL00984:Cds2 APN 2 132298521 missense probably benign 0.02
IGL02041:Cds2 APN 2 132294443 missense possibly damaging 0.94
sugarless UTSW 2 132298483 missense probably damaging 1.00
R0045:Cds2 UTSW 2 132305155 missense possibly damaging 0.67
R0045:Cds2 UTSW 2 132305155 missense possibly damaging 0.67
R0452:Cds2 UTSW 2 132298479 missense probably damaging 0.99
R0455:Cds2 UTSW 2 132285967 critical splice donor site probably null
R0593:Cds2 UTSW 2 132297376 unclassified probably benign
R0831:Cds2 UTSW 2 132285967 critical splice donor site probably null
R1053:Cds2 UTSW 2 132305260 missense probably damaging 1.00
R1669:Cds2 UTSW 2 132295519 splice site probably null
R1859:Cds2 UTSW 2 132302195 missense probably damaging 1.00
R4125:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4126:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4128:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4352:Cds2 UTSW 2 132263445 start codon destroyed probably null 0.37
R4467:Cds2 UTSW 2 132294446 nonsense probably null
R4698:Cds2 UTSW 2 132304953 missense probably damaging 0.97
R4704:Cds2 UTSW 2 132300602 nonsense probably null
R4917:Cds2 UTSW 2 132298478 missense probably damaging 0.98
R5070:Cds2 UTSW 2 132302088 nonsense probably null
R5199:Cds2 UTSW 2 132298483 missense probably damaging 1.00
R5431:Cds2 UTSW 2 132302170 missense probably benign 0.28
R5704:Cds2 UTSW 2 132293329 missense probably benign 0.01
R5858:Cds2 UTSW 2 132302113 missense probably benign 0.00
R5946:Cds2 UTSW 2 132297248 missense probably damaging 1.00
R5954:Cds2 UTSW 2 132297271 missense probably benign 0.00
R7195:Cds2 UTSW 2 132293284 missense probably benign 0.28
R7234:Cds2 UTSW 2 132304480 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAACTGATGTTCTTGCCTGCCCT -3'
(R):5'- CGTGCCAGAAACCCACCGT -3'

Sequencing Primer
(F):5'- CCTCTGCTCTTCGTCCTTAG -3'
(R):5'- ccagcaagggcattcacag -3'
Posted On2014-05-23