Incidental Mutation 'R1740:Speer4f1'
ID200269
Institutional Source Beutler Lab
Gene Symbol Speer4f1
Ensembl Gene ENSMUSG00000058643
Gene Namespermatogenesis associated glutamate (E)-rich protein 4F1
Synonyms4922502J04Rik, Speer4f, SPEER-4F
MMRRC Submission 039772-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R1740 (G1)
Quality Score217
Status Validated
Chromosome5
Chromosomal Location17476098-17480936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 17478761 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 141 (Y141S)
Ref Sequence ENSEMBL: ENSMUSP00000075467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076099]
Predicted Effect probably damaging
Transcript: ENSMUST00000076099
AA Change: Y141S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075467
Gene: ENSMUSG00000058643
AA Change: Y141S

DomainStartEndE-ValueType
Pfam:Takusan 50 128 1.2e-19 PFAM
low complexity region 224 258 N/A INTRINSIC
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,125 C417* probably null Het
4930548G14Rik G A 15: 46,625,489 noncoding transcript Het
Abcc12 T A 8: 86,505,497 K1311* probably null Het
Abcc12 T C 8: 86,509,771 D1138G possibly damaging Het
Adam32 A G 8: 24,921,298 S116P probably damaging Het
Arhgef26 C T 3: 62,423,583 L39F probably damaging Het
Babam1 T C 8: 71,403,019 I252T probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Ccdc109b A T 3: 129,918,727 H166Q probably benign Het
Ccdc61 G T 7: 18,903,937 probably benign Het
Ccdc89 C T 7: 90,426,738 S52F probably damaging Het
Cds2 T A 2: 132,302,213 I320N possibly damaging Het
Cebpe T C 14: 54,711,942 Y6C probably damaging Het
Cep250 T A 2: 155,973,356 I598N probably damaging Het
Cep350 T A 1: 155,928,833 I835F probably damaging Het
Ces3a T C 8: 105,048,685 L22P probably damaging Het
Cfap221 T C 1: 119,945,828 S490G probably benign Het
Cyp2j11 A G 4: 96,319,376 V234A probably benign Het
Dgat1 T C 15: 76,502,729 H399R probably damaging Het
Dnah10 A T 5: 124,773,190 probably null Het
Ebpl T G 14: 61,341,207 K193T probably benign Het
Elmsan1 T C 12: 84,172,902 E426G probably damaging Het
Entpd5 T C 12: 84,396,771 N66S probably benign Het
Fcgbp G T 7: 28,101,249 G1240V possibly damaging Het
Gabra5 A G 7: 57,421,842 S209P probably benign Het
Glce A T 9: 62,070,533 V23D probably damaging Het
Gm14226 GACTGTTAC GAC 2: 155,024,931 probably benign Het
Gtf2h1 A G 7: 46,812,466 N296S probably null Het
Herc6 T C 6: 57,652,065 S654P probably benign Het
Kcnk3 A T 5: 30,621,977 M124L possibly damaging Het
Lamb2 T G 9: 108,481,928 V281G probably damaging Het
Lctl A T 9: 64,133,107 D444V probably damaging Het
Mcm2 A G 6: 88,884,044 F891L probably damaging Het
Mical2 G T 7: 112,333,836 R739L probably benign Het
Mkrn2 G T 6: 115,613,369 A229S probably damaging Het
Mmp7 A G 9: 7,695,277 Y80C possibly damaging Het
Mpp2 T C 11: 102,062,396 probably null Het
Msh6 C A 17: 87,985,722 T635K possibly damaging Het
Mvd T A 8: 122,436,547 T315S probably benign Het
Myocd C T 11: 65,218,521 probably benign Het
Nav1 C T 1: 135,458,389 probably null Het
Olfr1298 T A 2: 111,645,869 I43F probably damaging Het
Pde4b A T 4: 102,487,351 D141V probably damaging Het
Pdgfrb A T 18: 61,081,833 D978V possibly damaging Het
Prss55 T C 14: 64,075,680 T252A probably damaging Het
Psd3 A T 8: 68,120,839 V230E probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptprn A G 1: 75,262,050 V82A probably damaging Het
Ptpru G T 4: 131,793,678 probably null Het
Raph1 T A 1: 60,519,024 K258* probably null Het
Rnf25 A G 1: 74,598,727 V28A probably damaging Het
Slc25a4 C T 8: 46,208,503 V212M probably benign Het
Slc39a3 T C 10: 81,031,508 S135G probably damaging Het
Slco6d1 A G 1: 98,428,372 I220M probably damaging Het
Smim19 G T 8: 22,473,528 Y21* probably null Het
Srgap2 G A 1: 131,289,388 P1062L probably benign Het
Stra8 A T 6: 34,927,719 probably benign Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem40 A G 6: 115,738,999 S76P probably benign Het
Unc13b C T 4: 43,240,285 R3569W probably damaging Het
Vmn1r128 A T 7: 21,349,944 Q191L probably benign Het
Washc2 T A 6: 116,231,632 probably benign Het
Other mutations in Speer4f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03344:Speer4f1 APN 5 17480334 missense possibly damaging 0.88
IGL02837:Speer4f1 UTSW 5 17480383 missense unknown
PIT4508001:Speer4f1 UTSW 5 17480414 missense unknown
PIT4514001:Speer4f1 UTSW 5 17478756 missense possibly damaging 0.94
R0165:Speer4f1 UTSW 5 17479514 nonsense probably null
R1557:Speer4f1 UTSW 5 17479492 missense probably damaging 1.00
R2332:Speer4f1 UTSW 5 17479524 missense probably damaging 0.99
R3890:Speer4f1 UTSW 5 17479502 missense probably damaging 0.98
R4659:Speer4f1 UTSW 5 17476223 missense possibly damaging 0.75
R4718:Speer4f1 UTSW 5 17480424 missense unknown
R5322:Speer4f1 UTSW 5 17477349 missense possibly damaging 0.47
R6075:Speer4f1 UTSW 5 17479484 missense possibly damaging 0.95
R6134:Speer4f1 UTSW 5 17476142 missense probably benign 0.10
R6192:Speer4f1 UTSW 5 17479495 missense probably damaging 1.00
R6277:Speer4f1 UTSW 5 17476243 missense probably damaging 0.99
R6803:Speer4f1 UTSW 5 17479390 splice site probably null
Z1088:Speer4f1 UTSW 5 17479479 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCACCTGAATGCCTAGCTTCTGAC -3'
(R):5'- TCTATTGGCTCCTGAGGATGCCTG -3'

Sequencing Primer
(F):5'- AGCCAGTTTCCCAAGGTTAAG -3'
(R):5'- ACTGGCAGTGGTAACAGTCTC -3'
Posted On2014-05-23