Incidental Mutation 'R1740:Myocd'
ID200298
Institutional Source Beutler Lab
Gene Symbol Myocd
Ensembl Gene ENSMUSG00000020542
Gene Namemyocardin
SynonymsSrfcp
MMRRC Submission 039772-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1740 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location65176561-65269989 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 65218521 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101042] [ENSMUST00000102635] [ENSMUST00000108695]
Predicted Effect probably benign
Transcript: ENSMUST00000101042
SMART Domains Protein: ENSMUSP00000098603
Gene: ENSMUSG00000020542

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
SCOP:d1lsha3 140 221 4e-3 SMART
SAP 252 286 1.29e-8 SMART
low complexity region 326 343 N/A INTRINSIC
low complexity region 371 383 N/A INTRINSIC
coiled coil region 396 435 N/A INTRINSIC
low complexity region 557 573 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102635
SMART Domains Protein: ENSMUSP00000099695
Gene: ENSMUSG00000020542

DomainStartEndE-ValueType
RPEL 18 43 4e-1 SMART
RPEL 62 87 9.26e0 SMART
RPEL 106 131 1.15e-6 SMART
low complexity region 147 160 N/A INTRINSIC
low complexity region 247 260 N/A INTRINSIC
SCOP:d1lsha3 268 349 4e-3 SMART
SAP 380 414 1.29e-8 SMART
low complexity region 454 471 N/A INTRINSIC
low complexity region 499 511 N/A INTRINSIC
coiled coil region 524 563 N/A INTRINSIC
low complexity region 695 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108695
SMART Domains Protein: ENSMUSP00000104335
Gene: ENSMUSG00000020542

DomainStartEndE-ValueType
RPEL 18 43 4e-1 SMART
RPEL 62 87 9.26e0 SMART
RPEL 106 131 1.15e-6 SMART
low complexity region 147 160 N/A INTRINSIC
low complexity region 247 260 N/A INTRINSIC
SCOP:d1lsha3 268 349 5e-3 SMART
SAP 380 414 1.29e-8 SMART
low complexity region 454 471 N/A INTRINSIC
low complexity region 499 511 N/A INTRINSIC
coiled coil region 524 563 N/A INTRINSIC
low complexity region 685 701 N/A INTRINSIC
low complexity region 743 757 N/A INTRINSIC
Meta Mutation Damage Score 0.1556 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein, which is expressed in heart, aorta, and in smooth muscle cell-containing tissues. It functions as a transcriptional co-activator of serum response factor (SRF) and modulates expression of cardiac and smooth muscle-specific SRF-target genes, and thus may play a crucial role in cardiogenesis and differentiation of the smooth muscle cell lineage. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null mutation exhibit embryonic lethality and fail to form vascular smooth muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,125 C417* probably null Het
4930548G14Rik G A 15: 46,625,489 noncoding transcript Het
Abcc12 T A 8: 86,505,497 K1311* probably null Het
Abcc12 T C 8: 86,509,771 D1138G possibly damaging Het
Adam32 A G 8: 24,921,298 S116P probably damaging Het
Arhgef26 C T 3: 62,423,583 L39F probably damaging Het
Babam1 T C 8: 71,403,019 I252T probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Ccdc109b A T 3: 129,918,727 H166Q probably benign Het
Ccdc61 G T 7: 18,903,937 probably benign Het
Ccdc89 C T 7: 90,426,738 S52F probably damaging Het
Cds2 T A 2: 132,302,213 I320N possibly damaging Het
Cebpe T C 14: 54,711,942 Y6C probably damaging Het
Cep250 T A 2: 155,973,356 I598N probably damaging Het
Cep350 T A 1: 155,928,833 I835F probably damaging Het
Ces3a T C 8: 105,048,685 L22P probably damaging Het
Cfap221 T C 1: 119,945,828 S490G probably benign Het
Cyp2j11 A G 4: 96,319,376 V234A probably benign Het
Dgat1 T C 15: 76,502,729 H399R probably damaging Het
Dnah10 A T 5: 124,773,190 probably null Het
Ebpl T G 14: 61,341,207 K193T probably benign Het
Elmsan1 T C 12: 84,172,902 E426G probably damaging Het
Entpd5 T C 12: 84,396,771 N66S probably benign Het
Fcgbp G T 7: 28,101,249 G1240V possibly damaging Het
Gabra5 A G 7: 57,421,842 S209P probably benign Het
Glce A T 9: 62,070,533 V23D probably damaging Het
Gm14226 GACTGTTAC GAC 2: 155,024,931 probably benign Het
Gtf2h1 A G 7: 46,812,466 N296S probably null Het
Herc6 T C 6: 57,652,065 S654P probably benign Het
Kcnk3 A T 5: 30,621,977 M124L possibly damaging Het
Lamb2 T G 9: 108,481,928 V281G probably damaging Het
Lctl A T 9: 64,133,107 D444V probably damaging Het
Mcm2 A G 6: 88,884,044 F891L probably damaging Het
Mical2 G T 7: 112,333,836 R739L probably benign Het
Mkrn2 G T 6: 115,613,369 A229S probably damaging Het
Mmp7 A G 9: 7,695,277 Y80C possibly damaging Het
Mpp2 T C 11: 102,062,396 probably null Het
Msh6 C A 17: 87,985,722 T635K possibly damaging Het
Mvd T A 8: 122,436,547 T315S probably benign Het
Nav1 C T 1: 135,458,389 probably null Het
Olfr1298 T A 2: 111,645,869 I43F probably damaging Het
Pde4b A T 4: 102,487,351 D141V probably damaging Het
Pdgfrb A T 18: 61,081,833 D978V possibly damaging Het
Prss55 T C 14: 64,075,680 T252A probably damaging Het
Psd3 A T 8: 68,120,839 V230E probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptprn A G 1: 75,262,050 V82A probably damaging Het
Ptpru G T 4: 131,793,678 probably null Het
Raph1 T A 1: 60,519,024 K258* probably null Het
Rnf25 A G 1: 74,598,727 V28A probably damaging Het
Slc25a4 C T 8: 46,208,503 V212M probably benign Het
Slc39a3 T C 10: 81,031,508 S135G probably damaging Het
Slco6d1 A G 1: 98,428,372 I220M probably damaging Het
Smim19 G T 8: 22,473,528 Y21* probably null Het
Speer4f1 A C 5: 17,478,761 Y141S probably damaging Het
Srgap2 G A 1: 131,289,388 P1062L probably benign Het
Stra8 A T 6: 34,927,719 probably benign Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem40 A G 6: 115,738,999 S76P probably benign Het
Unc13b C T 4: 43,240,285 R3569W probably damaging Het
Vmn1r128 A T 7: 21,349,944 Q191L probably benign Het
Washc2 T A 6: 116,231,632 probably benign Het
Other mutations in Myocd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Myocd APN 11 65180944 critical splice acceptor site probably null
IGL00481:Myocd APN 11 65187154 missense probably damaging 0.99
IGL00857:Myocd APN 11 65178836 missense possibly damaging 0.93
IGL01012:Myocd APN 11 65184625 missense possibly damaging 0.51
IGL01570:Myocd APN 11 65200807 missense probably benign 0.00
IGL01865:Myocd APN 11 65200897 missense probably benign 0.30
IGL01938:Myocd APN 11 65187088 missense probably damaging 1.00
IGL02324:Myocd APN 11 65178658 missense probably benign 0.01
IGL02598:Myocd APN 11 65183470 missense probably benign 0.31
IGL02886:Myocd APN 11 65178743 missense probably damaging 0.99
IGL03008:Myocd APN 11 65187566 missense probably damaging 0.98
IGL03034:Myocd APN 11 65218685 missense probably benign 0.00
harvey UTSW 11 65179030 splice site probably null
irma UTSW 11 65196394 missense probably damaging 0.97
Nate UTSW 11 65233088 intron probably null
R0078:Myocd UTSW 11 65187464 missense possibly damaging 0.96
R0097:Myocd UTSW 11 65179014 missense possibly damaging 0.67
R0097:Myocd UTSW 11 65179014 missense possibly damaging 0.67
R0234:Myocd UTSW 11 65187240 missense probably benign 0.01
R0234:Myocd UTSW 11 65187240 missense probably benign 0.01
R0453:Myocd UTSW 11 65196225 missense probably damaging 1.00
R0523:Myocd UTSW 11 65180902 missense probably damaging 1.00
R0838:Myocd UTSW 11 65178932 missense probably benign 0.00
R0899:Myocd UTSW 11 65195192 missense possibly damaging 0.50
R1167:Myocd UTSW 11 65196377 missense possibly damaging 0.77
R1472:Myocd UTSW 11 65187504 missense probably benign 0.01
R1508:Myocd UTSW 11 65184516 missense probably damaging 0.98
R1620:Myocd UTSW 11 65196394 missense probably damaging 0.97
R1630:Myocd UTSW 11 65196394 missense probably damaging 0.97
R1731:Myocd UTSW 11 65200888 missense probably benign 0.30
R1769:Myocd UTSW 11 65178701 missense probably benign 0.01
R1823:Myocd UTSW 11 65178670 missense probably benign 0.00
R1968:Myocd UTSW 11 65200907 missense probably damaging 1.00
R1997:Myocd UTSW 11 65204321 nonsense probably null
R2018:Myocd UTSW 11 65187028 missense probably damaging 1.00
R2105:Myocd UTSW 11 65218658 nonsense probably null
R2314:Myocd UTSW 11 65200807 missense probably damaging 1.00
R4330:Myocd UTSW 11 65223764 missense probably benign 0.12
R4331:Myocd UTSW 11 65223764 missense probably benign 0.12
R4603:Myocd UTSW 11 65187745 missense possibly damaging 0.82
R4619:Myocd UTSW 11 65178428 utr 3 prime probably benign
R4631:Myocd UTSW 11 65178859 missense probably benign 0.10
R4865:Myocd UTSW 11 65179030 splice site probably null
R4974:Myocd UTSW 11 65183473 missense possibly damaging 0.78
R4976:Myocd UTSW 11 65222050 missense probably benign 0.00
R5478:Myocd UTSW 11 65233088 intron probably null
R5499:Myocd UTSW 11 65178749 missense possibly damaging 0.62
R6052:Myocd UTSW 11 65196256 missense probably damaging 1.00
R6356:Myocd UTSW 11 65218570 unclassified probably null
R7144:Myocd UTSW 11 65218648 missense probably damaging 1.00
R7261:Myocd UTSW 11 65187596 missense probably damaging 0.98
R7354:Myocd UTSW 11 65187493 missense probably benign 0.00
R7461:Myocd UTSW 11 65218603 missense probably damaging 1.00
X0057:Myocd UTSW 11 65183445 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AAGACAGTGGACCTCTGAGTGTGG -3'
(R):5'- TCAAAATGGTAGAGCGTGGTGTGAC -3'

Sequencing Primer
(F):5'- AAATCCCTGGATTGCCAGAG -3'
(R):5'- GACACAGTGTTTTCTAACCAGCAG -3'
Posted On2014-05-23