Incidental Mutation 'R1740:Pdgfrb'
ID200311
Institutional Source Beutler Lab
Gene Symbol Pdgfrb
Ensembl Gene ENSMUSG00000024620
Gene Nameplatelet derived growth factor receptor, beta polypeptide
SynonymsCD140b, Pdgfr
MMRRC Submission 039772-MU
Accession Numbers

Ncbi RefSeq: NM_001146268.1, NM_008809.2; MGI:97531

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1740 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location61045150-61085061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61081833 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 978 (D978V)
Ref Sequence ENSEMBL: ENSMUSP00000110929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025522] [ENSMUST00000115274]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025522
AA Change: D974V

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025522
Gene: ENSMUSG00000024620
AA Change: D974V

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
IG 38 120 5.58e-2 SMART
IGc2 225 297 2.83e-12 SMART
IG_like 330 402 1.47e0 SMART
Pfam:Ig_2 415 524 5.6e-2 PFAM
transmembrane domain 534 556 N/A INTRINSIC
TyrKc 600 958 1.11e-135 SMART
low complexity region 1063 1083 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115274
AA Change: D978V

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110929
Gene: ENSMUSG00000024620
AA Change: D978V

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 42 124 5.58e-2 SMART
IGc2 229 301 2.83e-12 SMART
IG_like 334 406 1.47e0 SMART
transmembrane domain 538 560 N/A INTRINSIC
TyrKc 604 962 1.11e-135 SMART
low complexity region 1067 1087 N/A INTRINSIC
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 99% (69/70)
MGI Phenotype Strain: 2682393; 2135508
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. These growth factors are mitogens for cells of mesenchymal origin. The identity of the growth factor bound to a receptor monomer determines whether the functional receptor is a homodimer or a heterodimer, composed of both platelet-derived growth factor receptor alpha and beta polypeptides. This gene is flanked on chromosome 5 by the genes for granulocyte-macrophage colony-stimulating factor and macrophage-colony stimulating factor receptor; all three genes may be implicated in the 5-q syndrome. A translocation between chromosomes 5 and 12, that fuses this gene to that of the translocation, ETV6, leukemia gene, results in chronic myeloproliferative disorder with eosinophilia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die perinatally with internal bleeding, thrombocytopenia, anemia and kidney defects. A frameshift mutation results in neonatal lethals with edema and hemorrhaging; several point mutations show cardiovascular abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(23) Gene trapped(2)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,125 C417* probably null Het
4930548G14Rik G A 15: 46,625,489 noncoding transcript Het
Abcc12 T A 8: 86,505,497 K1311* probably null Het
Abcc12 T C 8: 86,509,771 D1138G possibly damaging Het
Adam32 A G 8: 24,921,298 S116P probably damaging Het
Arhgef26 C T 3: 62,423,583 L39F probably damaging Het
Babam1 T C 8: 71,403,019 I252T probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Ccdc109b A T 3: 129,918,727 H166Q probably benign Het
Ccdc61 G T 7: 18,903,937 probably benign Het
Ccdc89 C T 7: 90,426,738 S52F probably damaging Het
Cds2 T A 2: 132,302,213 I320N possibly damaging Het
Cebpe T C 14: 54,711,942 Y6C probably damaging Het
Cep250 T A 2: 155,973,356 I598N probably damaging Het
Cep350 T A 1: 155,928,833 I835F probably damaging Het
Ces3a T C 8: 105,048,685 L22P probably damaging Het
Cfap221 T C 1: 119,945,828 S490G probably benign Het
Cyp2j11 A G 4: 96,319,376 V234A probably benign Het
Dgat1 T C 15: 76,502,729 H399R probably damaging Het
Dnah10 A T 5: 124,773,190 probably null Het
Ebpl T G 14: 61,341,207 K193T probably benign Het
Elmsan1 T C 12: 84,172,902 E426G probably damaging Het
Entpd5 T C 12: 84,396,771 N66S probably benign Het
Fcgbp G T 7: 28,101,249 G1240V possibly damaging Het
Gabra5 A G 7: 57,421,842 S209P probably benign Het
Glce A T 9: 62,070,533 V23D probably damaging Het
Gm14226 GACTGTTAC GAC 2: 155,024,931 probably benign Het
Gtf2h1 A G 7: 46,812,466 N296S probably null Het
Herc6 T C 6: 57,652,065 S654P probably benign Het
Kcnk3 A T 5: 30,621,977 M124L possibly damaging Het
Lamb2 T G 9: 108,481,928 V281G probably damaging Het
Lctl A T 9: 64,133,107 D444V probably damaging Het
Mcm2 A G 6: 88,884,044 F891L probably damaging Het
Mical2 G T 7: 112,333,836 R739L probably benign Het
Mkrn2 G T 6: 115,613,369 A229S probably damaging Het
Mmp7 A G 9: 7,695,277 Y80C possibly damaging Het
Mpp2 T C 11: 102,062,396 probably null Het
Msh6 C A 17: 87,985,722 T635K possibly damaging Het
Mvd T A 8: 122,436,547 T315S probably benign Het
Myocd C T 11: 65,218,521 probably benign Het
Nav1 C T 1: 135,458,389 probably null Het
Olfr1298 T A 2: 111,645,869 I43F probably damaging Het
Pde4b A T 4: 102,487,351 D141V probably damaging Het
Prss55 T C 14: 64,075,680 T252A probably damaging Het
Psd3 A T 8: 68,120,839 V230E probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptprn A G 1: 75,262,050 V82A probably damaging Het
Ptpru G T 4: 131,793,678 probably null Het
Raph1 T A 1: 60,519,024 K258* probably null Het
Rnf25 A G 1: 74,598,727 V28A probably damaging Het
Slc25a4 C T 8: 46,208,503 V212M probably benign Het
Slc39a3 T C 10: 81,031,508 S135G probably damaging Het
Slco6d1 A G 1: 98,428,372 I220M probably damaging Het
Smim19 G T 8: 22,473,528 Y21* probably null Het
Speer4f1 A C 5: 17,478,761 Y141S probably damaging Het
Srgap2 G A 1: 131,289,388 P1062L probably benign Het
Stra8 A T 6: 34,927,719 probably benign Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem40 A G 6: 115,738,999 S76P probably benign Het
Unc13b C T 4: 43,240,285 R3569W probably damaging Het
Vmn1r128 A T 7: 21,349,944 Q191L probably benign Het
Washc2 T A 6: 116,231,632 probably benign Het
Other mutations in Pdgfrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Pdgfrb APN 18 61068936 missense probably benign 0.20
IGL01396:Pdgfrb APN 18 61072664 missense probably damaging 1.00
IGL02377:Pdgfrb APN 18 61080332 missense probably damaging 1.00
IGL02435:Pdgfrb APN 18 61064926 critical splice donor site probably null
IGL03397:Pdgfrb APN 18 61079681 missense probably benign 0.28
R0021:Pdgfrb UTSW 18 61064926 critical splice donor site probably benign
R0021:Pdgfrb UTSW 18 61064926 critical splice donor site probably benign
R0087:Pdgfrb UTSW 18 61061513 missense probably damaging 1.00
R0119:Pdgfrb UTSW 18 61068852 missense probably benign 0.06
R0299:Pdgfrb UTSW 18 61068852 missense probably benign 0.06
R0532:Pdgfrb UTSW 18 61083265 missense probably damaging 1.00
R0570:Pdgfrb UTSW 18 61077703 missense probably benign 0.00
R0629:Pdgfrb UTSW 18 61078648 critical splice donor site probably null
R0650:Pdgfrb UTSW 18 61079708 missense probably benign 0.00
R0853:Pdgfrb UTSW 18 61080327 missense probably damaging 1.00
R1165:Pdgfrb UTSW 18 61064002 missense probably benign 0.01
R1342:Pdgfrb UTSW 18 61065880 nonsense probably null
R1808:Pdgfrb UTSW 18 61068102 missense probably benign
R1864:Pdgfrb UTSW 18 61071717 missense probably benign 0.00
R1960:Pdgfrb UTSW 18 61065783 missense probably benign 0.05
R1961:Pdgfrb UTSW 18 61061505 missense possibly damaging 0.49
R1970:Pdgfrb UTSW 18 61066494 splice site probably benign
R2011:Pdgfrb UTSW 18 61061494 missense probably benign 0.01
R2012:Pdgfrb UTSW 18 61061494 missense probably benign 0.01
R2018:Pdgfrb UTSW 18 61083334 missense possibly damaging 0.84
R2153:Pdgfrb UTSW 18 61072756 missense probably damaging 1.00
R2497:Pdgfrb UTSW 18 61078628 missense possibly damaging 0.58
R2846:Pdgfrb UTSW 18 61064016 missense probably benign 0.00
R3776:Pdgfrb UTSW 18 61081920 missense probably benign 0.00
R3779:Pdgfrb UTSW 18 61072666 missense probably damaging 1.00
R3816:Pdgfrb UTSW 18 61078945 missense probably damaging 1.00
R3978:Pdgfrb UTSW 18 61073685 missense probably damaging 1.00
R4259:Pdgfrb UTSW 18 61077631 missense probably benign 0.00
R4261:Pdgfrb UTSW 18 61077631 missense probably benign 0.00
R4327:Pdgfrb UTSW 18 61071720 missense possibly damaging 0.83
R4329:Pdgfrb UTSW 18 61071720 missense possibly damaging 0.83
R4598:Pdgfrb UTSW 18 61068757 missense probably benign 0.03
R4668:Pdgfrb UTSW 18 61064113 missense probably damaging 1.00
R4761:Pdgfrb UTSW 18 61079700 missense probably damaging 1.00
R4787:Pdgfrb UTSW 18 61079687 missense probably damaging 1.00
R4828:Pdgfrb UTSW 18 61073243 missense probably damaging 0.98
R5030:Pdgfrb UTSW 18 61065135 missense probably benign 0.13
R5033:Pdgfrb UTSW 18 61077668 missense probably damaging 1.00
R5447:Pdgfrb UTSW 18 61068108 missense probably damaging 1.00
R6224:Pdgfrb UTSW 18 61081939 nonsense probably null
R6807:Pdgfrb UTSW 18 61078649 critical splice donor site probably null
R6858:Pdgfrb UTSW 18 61065147 missense probably benign 0.01
X0060:Pdgfrb UTSW 18 61081976 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCCTGGCTACTATGCTTGACTAC -3'
(R):5'- CTCTGGGAGACCTTCATCAGCAAC -3'

Sequencing Primer
(F):5'- ACTATGCTTGACTACCTGCC -3'
(R):5'- accttcatcagcaacgtcag -3'
Posted On2014-05-23