Incidental Mutation 'R1741:Wfdc8'
ID200325
Institutional Source Beutler Lab
Gene Symbol Wfdc8
Ensembl Gene ENSMUSG00000070533
Gene NameWAP four-disulfide core domain 8
SynonymsLOC277343
MMRRC Submission 039773-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1741 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location164596458-164613626 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to G at 164608869 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094346] [ENSMUST00000094351] [ENSMUST00000109338] [ENSMUST00000109339]
Predicted Effect probably benign
Transcript: ENSMUST00000094346
SMART Domains Protein: ENSMUSP00000091906
Gene: ENSMUSG00000070531

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
WAP 42 84 2.99e-1 SMART
KU 86 139 7.78e-26 SMART
Predicted Effect unknown
Transcript: ENSMUST00000094351
AA Change: R9S
SMART Domains Protein: ENSMUSP00000091911
Gene: ENSMUSG00000070533
AA Change: R9S

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
WAP 79 123 1.88e-2 SMART
KU 125 178 8.81e-25 SMART
WAP 182 226 8.82e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000109338
AA Change: R9S
SMART Domains Protein: ENSMUSP00000104962
Gene: ENSMUSG00000070533
AA Change: R9S

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
WAP 79 123 1.88e-2 SMART
KU 125 178 8.81e-25 SMART
WAP 182 226 8.82e-6 SMART
WAP 229 272 1.84e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000109339
AA Change: R9S
SMART Domains Protein: ENSMUSP00000104963
Gene: ENSMUSG00000070533
AA Change: R9S

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
WAP 79 123 1.88e-2 SMART
KU 125 178 8.81e-25 SMART
WAP 182 226 8.82e-6 SMART
low complexity region 300 313 N/A INTRINSIC
low complexity region 384 393 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WAP-type four-disulfide core (WFDC) domain family. The WFDC domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor. The encoded protein contains a Kunitz-inhibitor domain, in addition to three WFDC domains. Most WFDC genes are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the telomeric cluster. Two alternatively spliced transcript variants have been found for this gene, and they encode the same protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,660,506 N37S probably damaging Het
9530053A07Rik G T 7: 28,157,854 C2209F probably damaging Het
Acad10 T C 5: 121,647,836 K230R probably damaging Het
Actl7a A G 4: 56,744,252 N260D probably benign Het
Adam24 T C 8: 40,679,603 Y37H probably benign Het
Ahcy G A 2: 155,064,234 A229V probably benign Het
Ap3b2 A G 7: 81,467,599 V563A possibly damaging Het
Bcl9l T A 9: 44,509,689 M1427K probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Btg4 A T 9: 51,116,610 I27L probably benign Het
Ccdc171 A G 4: 83,620,839 Y366C probably damaging Het
Chd3 A G 11: 69,355,654 Y1085H probably damaging Het
Cnot10 T C 9: 114,597,824 D616G possibly damaging Het
Crlf1 C A 8: 70,500,906 D243E probably damaging Het
Cyp2b23 A G 7: 26,673,077 V371A possibly damaging Het
Dennd2a A G 6: 39,493,157 S534P probably damaging Het
Eln A G 5: 134,729,184 V185A unknown Het
Epor C T 9: 21,959,771 G301D probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl21 A T 13: 56,537,102 T340S probably benign Het
Fez1 T A 9: 36,843,733 D9E probably damaging Het
Fsip2 T C 2: 82,989,912 F5330L probably benign Het
Glis1 G A 4: 107,568,347 R197Q probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gpr158 A G 2: 21,827,548 N1153S probably benign Het
Gramd4 T C 15: 86,091,529 probably null Het
Hhatl T A 9: 121,789,059 Y210F possibly damaging Het
Hltf T C 3: 20,086,188 W422R probably damaging Het
Hspa5 T C 2: 34,772,692 S87P possibly damaging Het
Il21 T C 3: 37,227,662 H111R probably benign Het
Ip6k1 G A 9: 108,040,984 G73S probably benign Het
Kdm5b A G 1: 134,618,017 D972G possibly damaging Het
Kif21b C T 1: 136,156,142 A709V probably damaging Het
Kmt2d T C 15: 98,845,234 probably benign Het
Lrrc14b A G 13: 74,363,586 L125P probably damaging Het
Mapk8ip3 A G 17: 24,899,854 S1169P probably damaging Het
Me3 A T 7: 89,851,833 Y584F probably damaging Het
Mxra7 T G 11: 116,816,244 probably null Het
Nf1 T C 11: 79,443,931 S870P probably benign Het
Npr2 G A 4: 43,643,350 G525S probably damaging Het
Nyap1 A T 5: 137,733,125 S726T probably damaging Het
Padi4 A G 4: 140,746,170 V652A probably damaging Het
Pclo A G 5: 14,676,510 probably benign Het
Pgm2 G A 4: 99,964,865 probably null Het
Piezo2 A G 18: 63,021,173 S2512P probably damaging Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpn3 A G 4: 57,254,922 V154A probably damaging Het
Rassf4 T C 6: 116,639,489 E287G probably damaging Het
Rnh1 C T 7: 141,164,023 R174H probably benign Het
Scn9a T A 2: 66,487,594 I1517F probably damaging Het
Sftpb C A 6: 72,305,813 A90E probably benign Het
Slc39a14 T C 14: 70,318,744 K61R probably damaging Het
Tmem132d A C 5: 127,784,858 M733R probably benign Het
Tmem248 A G 5: 130,236,823 I156V probably benign Het
Traf2 T C 2: 25,524,483 D339G probably damaging Het
Trappc11 A G 8: 47,529,327 probably null Het
Tuba8 T A 6: 121,222,768 I137N possibly damaging Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp34 A G 11: 23,364,103 T663A probably benign Het
Vmn2r26 T A 6: 124,061,472 F669I probably damaging Het
Wdr95 G A 5: 149,595,396 probably null Het
Zfp64 A C 2: 168,926,318 V458G probably benign Het
Zfp868 C T 8: 69,611,868 G272D probably damaging Het
Other mutations in Wfdc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01896:Wfdc8 APN 2 164605780 missense probably damaging 1.00
IGL02012:Wfdc8 APN 2 164603150 splice site probably benign
IGL02831:Wfdc8 APN 2 164605765 critical splice donor site probably null
PIT4131001:Wfdc8 UTSW 2 164597776 missense possibly damaging 0.94
PIT4520001:Wfdc8 UTSW 2 164603303 missense probably benign 0.09
R0006:Wfdc8 UTSW 2 164599064 missense probably damaging 0.96
R0225:Wfdc8 UTSW 2 164597185 missense probably benign 0.04
R0603:Wfdc8 UTSW 2 164603225 missense probably damaging 1.00
R5484:Wfdc8 UTSW 2 164597729 missense probably benign 0.11
R5546:Wfdc8 UTSW 2 164597319 utr 3 prime probably benign
R5614:Wfdc8 UTSW 2 164603203 missense probably damaging 1.00
R5668:Wfdc8 UTSW 2 164597419 utr 3 prime probably benign
R6410:Wfdc8 UTSW 2 164597743 missense probably benign 0.10
R6869:Wfdc8 UTSW 2 164599092 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GACGCACGCACGTTTGATCTTG -3'
(R):5'- AAAGGCCCCACTGAATCATGTCTG -3'

Sequencing Primer
(F):5'- ATGTTGAGGTCTGCTCCAAG -3'
(R):5'- GCAGTTTCTTCAGACAGAAGCAC -3'
Posted On2014-05-23