Incidental Mutation 'R1741:Zfp64'
ID200326
Institutional Source Beutler Lab
Gene Symbol Zfp64
Ensembl Gene ENSMUSG00000027551
Gene Namezinc finger protein 64
Synonyms
MMRRC Submission 039773-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.882) question?
Stock #R1741 (G1)
Quality Score218
Status Not validated
Chromosome2
Chromosomal Location168893331-168955587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 168926318 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 458 (V458G)
Ref Sequence ENSEMBL: ENSMUSP00000085285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087971] [ENSMUST00000109162]
Predicted Effect probably benign
Transcript: ENSMUST00000087971
AA Change: V458G

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000085285
Gene: ENSMUSG00000027551
AA Change: V458G

DomainStartEndE-ValueType
ZnF_C2H2 31 51 5.54e1 SMART
low complexity region 71 93 N/A INTRINSIC
ZnF_C2H2 142 167 1.68e1 SMART
ZnF_C2H2 173 195 2.24e-3 SMART
ZnF_C2H2 201 223 1.58e-3 SMART
ZnF_C2H2 229 251 2.24e-3 SMART
ZnF_C2H2 257 279 3.89e-3 SMART
ZnF_C2H2 285 308 6.32e-3 SMART
ZnF_C2H2 313 335 2.05e-2 SMART
ZnF_C2H2 341 363 1.95e-3 SMART
ZnF_C2H2 369 392 1.36e-2 SMART
ZnF_C2H2 423 445 1.47e-3 SMART
low complexity region 503 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109162
SMART Domains Protein: ENSMUSP00000104790
Gene: ENSMUSG00000027551

DomainStartEndE-ValueType
ZnF_C2H2 31 51 5.54e1 SMART
low complexity region 71 93 N/A INTRINSIC
ZnF_C2H2 142 167 1.68e1 SMART
ZnF_C2H2 173 195 2.24e-3 SMART
ZnF_C2H2 201 223 1.58e-3 SMART
ZnF_C2H2 229 251 2.24e-3 SMART
ZnF_C2H2 297 322 5.2e0 SMART
ZnF_C2H2 328 350 4.17e-3 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.24e-3 SMART
ZnF_C2H2 412 434 1.79e-2 SMART
ZnF_C2H2 440 463 9.58e-3 SMART
ZnF_C2H2 465 487 3.78e-1 SMART
ZnF_C2H2 493 515 3.89e-3 SMART
ZnF_C2H2 521 544 1.92e-2 SMART
ZnF_C2H2 578 600 5.34e-1 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,660,506 N37S probably damaging Het
9530053A07Rik G T 7: 28,157,854 C2209F probably damaging Het
Acad10 T C 5: 121,647,836 K230R probably damaging Het
Actl7a A G 4: 56,744,252 N260D probably benign Het
Adam24 T C 8: 40,679,603 Y37H probably benign Het
Ahcy G A 2: 155,064,234 A229V probably benign Het
Ap3b2 A G 7: 81,467,599 V563A possibly damaging Het
Bcl9l T A 9: 44,509,689 M1427K probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Btg4 A T 9: 51,116,610 I27L probably benign Het
Ccdc171 A G 4: 83,620,839 Y366C probably damaging Het
Chd3 A G 11: 69,355,654 Y1085H probably damaging Het
Cnot10 T C 9: 114,597,824 D616G possibly damaging Het
Crlf1 C A 8: 70,500,906 D243E probably damaging Het
Cyp2b23 A G 7: 26,673,077 V371A possibly damaging Het
Dennd2a A G 6: 39,493,157 S534P probably damaging Het
Eln A G 5: 134,729,184 V185A unknown Het
Epor C T 9: 21,959,771 G301D probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl21 A T 13: 56,537,102 T340S probably benign Het
Fez1 T A 9: 36,843,733 D9E probably damaging Het
Fsip2 T C 2: 82,989,912 F5330L probably benign Het
Glis1 G A 4: 107,568,347 R197Q probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gpr158 A G 2: 21,827,548 N1153S probably benign Het
Gramd4 T C 15: 86,091,529 probably null Het
Hhatl T A 9: 121,789,059 Y210F possibly damaging Het
Hltf T C 3: 20,086,188 W422R probably damaging Het
Hspa5 T C 2: 34,772,692 S87P possibly damaging Het
Il21 T C 3: 37,227,662 H111R probably benign Het
Ip6k1 G A 9: 108,040,984 G73S probably benign Het
Kdm5b A G 1: 134,618,017 D972G possibly damaging Het
Kif21b C T 1: 136,156,142 A709V probably damaging Het
Kmt2d T C 15: 98,845,234 probably benign Het
Lrrc14b A G 13: 74,363,586 L125P probably damaging Het
Mapk8ip3 A G 17: 24,899,854 S1169P probably damaging Het
Me3 A T 7: 89,851,833 Y584F probably damaging Het
Mxra7 T G 11: 116,816,244 probably null Het
Nf1 T C 11: 79,443,931 S870P probably benign Het
Npr2 G A 4: 43,643,350 G525S probably damaging Het
Nyap1 A T 5: 137,733,125 S726T probably damaging Het
Padi4 A G 4: 140,746,170 V652A probably damaging Het
Pclo A G 5: 14,676,510 probably benign Het
Pgm2 G A 4: 99,964,865 probably null Het
Piezo2 A G 18: 63,021,173 S2512P probably damaging Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpn3 A G 4: 57,254,922 V154A probably damaging Het
Rassf4 T C 6: 116,639,489 E287G probably damaging Het
Rnh1 C T 7: 141,164,023 R174H probably benign Het
Scn9a T A 2: 66,487,594 I1517F probably damaging Het
Sftpb C A 6: 72,305,813 A90E probably benign Het
Slc39a14 T C 14: 70,318,744 K61R probably damaging Het
Tmem132d A C 5: 127,784,858 M733R probably benign Het
Tmem248 A G 5: 130,236,823 I156V probably benign Het
Traf2 T C 2: 25,524,483 D339G probably damaging Het
Trappc11 A G 8: 47,529,327 probably null Het
Tuba8 T A 6: 121,222,768 I137N possibly damaging Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp34 A G 11: 23,364,103 T663A probably benign Het
Vmn2r26 T A 6: 124,061,472 F669I probably damaging Het
Wdr95 G A 5: 149,595,396 probably null Het
Wfdc8 T G 2: 164,608,869 probably benign Het
Zfp868 C T 8: 69,611,868 G272D probably damaging Het
Other mutations in Zfp64
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Zfp64 APN 2 168926681 missense probably benign 0.06
IGL01479:Zfp64 APN 2 168951679 missense probably damaging 1.00
IGL02320:Zfp64 APN 2 168926198 missense probably damaging 0.98
IGL03411:Zfp64 APN 2 168951542 splice site probably null
PIT4362001:Zfp64 UTSW 2 168925815 missense probably benign 0.23
R0033:Zfp64 UTSW 2 168925715 missense possibly damaging 0.94
R0033:Zfp64 UTSW 2 168925715 missense possibly damaging 0.94
R0230:Zfp64 UTSW 2 168912230 splice site probably benign
R0325:Zfp64 UTSW 2 168926040 missense probably benign 0.00
R0689:Zfp64 UTSW 2 168935201 splice site probably benign
R2054:Zfp64 UTSW 2 168925808 missense probably damaging 1.00
R2133:Zfp64 UTSW 2 168940743 missense probably damaging 1.00
R2254:Zfp64 UTSW 2 168926742 missense probably damaging 0.96
R4093:Zfp64 UTSW 2 168925935 missense probably benign 0.00
R4094:Zfp64 UTSW 2 168925935 missense probably benign 0.00
R4257:Zfp64 UTSW 2 168926378 missense probably damaging 1.00
R4630:Zfp64 UTSW 2 168926543 missense possibly damaging 0.94
R4642:Zfp64 UTSW 2 168934931 missense probably benign 0.22
R4817:Zfp64 UTSW 2 168926112 missense probably benign
R4880:Zfp64 UTSW 2 168894377 missense probably damaging 1.00
R5051:Zfp64 UTSW 2 168926384 missense probably damaging 0.98
R5155:Zfp64 UTSW 2 168906965 missense probably benign 0.17
R5562:Zfp64 UTSW 2 168925722 missense probably benign 0.00
R5619:Zfp64 UTSW 2 168899814 missense probably damaging 0.99
R5619:Zfp64 UTSW 2 168899815 missense probably damaging 0.97
R5620:Zfp64 UTSW 2 168899968 missense possibly damaging 0.70
R5919:Zfp64 UTSW 2 168926499 missense probably benign 0.05
R6156:Zfp64 UTSW 2 168926168 missense probably benign 0.34
R6364:Zfp64 UTSW 2 168912266 missense probably damaging 1.00
R6488:Zfp64 UTSW 2 168935209 critical splice donor site probably null
R6512:Zfp64 UTSW 2 168894077 missense probably benign 0.00
R6588:Zfp64 UTSW 2 168926907 missense probably damaging 1.00
R7103:Zfp64 UTSW 2 168926437 missense probably benign 0.00
R7313:Zfp64 UTSW 2 168899890 missense probably damaging 1.00
R7470:Zfp64 UTSW 2 168925811 missense probably damaging 1.00
R7529:Zfp64 UTSW 2 168894072 missense probably benign
R7560:Zfp64 UTSW 2 168925665 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATGAATGTCTGGTTTCCCGTGCC -3'
(R):5'- AAGTTCCACGCCGACATGCTCAAG -3'

Sequencing Primer
(F):5'- GCAATGAGACTGACCTGGC -3'
(R):5'- TGCTCAAGAACGAGGCTC -3'
Posted On2014-05-23