Incidental Mutation 'R1741:Tuba8'
ID200348
Institutional Source Beutler Lab
Gene Symbol Tuba8
Ensembl Gene ENSMUSG00000030137
Gene Nametubulin, alpha 8
Synonyms
MMRRC Submission 039773-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1741 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location121210696-121226854 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121222768 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 137 (I137N)
Ref Sequence ENSEMBL: ENSMUSP00000032233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032233]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032233
AA Change: I137N

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032233
Gene: ENSMUSG00000030137
AA Change: I137N

DomainStartEndE-ValueType
Tubulin 49 246 2.17e-79 SMART
Tubulin_C 248 393 3.76e-56 SMART
low complexity region 441 448 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124853
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the tubulin family of cytoskeletal proteins that form the integral component of microtubules. This gene is preferentially expressed in heart, skeletal muscle and testis. The encoded protein may play a role in liver tumorigenesis in mice. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele appear neurologically normal, progress to adulthood and exhibit normal fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,660,506 N37S probably damaging Het
9530053A07Rik G T 7: 28,157,854 C2209F probably damaging Het
Acad10 T C 5: 121,647,836 K230R probably damaging Het
Actl7a A G 4: 56,744,252 N260D probably benign Het
Adam24 T C 8: 40,679,603 Y37H probably benign Het
Ahcy G A 2: 155,064,234 A229V probably benign Het
Ap3b2 A G 7: 81,467,599 V563A possibly damaging Het
Bcl9l T A 9: 44,509,689 M1427K probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Btg4 A T 9: 51,116,610 I27L probably benign Het
Ccdc171 A G 4: 83,620,839 Y366C probably damaging Het
Chd3 A G 11: 69,355,654 Y1085H probably damaging Het
Cnot10 T C 9: 114,597,824 D616G possibly damaging Het
Crlf1 C A 8: 70,500,906 D243E probably damaging Het
Cyp2b23 A G 7: 26,673,077 V371A possibly damaging Het
Dennd2a A G 6: 39,493,157 S534P probably damaging Het
Eln A G 5: 134,729,184 V185A unknown Het
Epor C T 9: 21,959,771 G301D probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl21 A T 13: 56,537,102 T340S probably benign Het
Fez1 T A 9: 36,843,733 D9E probably damaging Het
Fsip2 T C 2: 82,989,912 F5330L probably benign Het
Glis1 G A 4: 107,568,347 R197Q probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gpr158 A G 2: 21,827,548 N1153S probably benign Het
Gramd4 T C 15: 86,091,529 probably null Het
Hhatl T A 9: 121,789,059 Y210F possibly damaging Het
Hltf T C 3: 20,086,188 W422R probably damaging Het
Hspa5 T C 2: 34,772,692 S87P possibly damaging Het
Il21 T C 3: 37,227,662 H111R probably benign Het
Ip6k1 G A 9: 108,040,984 G73S probably benign Het
Kdm5b A G 1: 134,618,017 D972G possibly damaging Het
Kif21b C T 1: 136,156,142 A709V probably damaging Het
Kmt2d T C 15: 98,845,234 probably benign Het
Lrrc14b A G 13: 74,363,586 L125P probably damaging Het
Mapk8ip3 A G 17: 24,899,854 S1169P probably damaging Het
Me3 A T 7: 89,851,833 Y584F probably damaging Het
Mxra7 T G 11: 116,816,244 probably null Het
Nf1 T C 11: 79,443,931 S870P probably benign Het
Npr2 G A 4: 43,643,350 G525S probably damaging Het
Nyap1 A T 5: 137,733,125 S726T probably damaging Het
Padi4 A G 4: 140,746,170 V652A probably damaging Het
Pclo A G 5: 14,676,510 probably benign Het
Pgm2 G A 4: 99,964,865 probably null Het
Piezo2 A G 18: 63,021,173 S2512P probably damaging Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpn3 A G 4: 57,254,922 V154A probably damaging Het
Rassf4 T C 6: 116,639,489 E287G probably damaging Het
Rnh1 C T 7: 141,164,023 R174H probably benign Het
Scn9a T A 2: 66,487,594 I1517F probably damaging Het
Sftpb C A 6: 72,305,813 A90E probably benign Het
Slc39a14 T C 14: 70,318,744 K61R probably damaging Het
Tmem132d A C 5: 127,784,858 M733R probably benign Het
Tmem248 A G 5: 130,236,823 I156V probably benign Het
Traf2 T C 2: 25,524,483 D339G probably damaging Het
Trappc11 A G 8: 47,529,327 probably null Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp34 A G 11: 23,364,103 T663A probably benign Het
Vmn2r26 T A 6: 124,061,472 F669I probably damaging Het
Wdr95 G A 5: 149,595,396 probably null Het
Wfdc8 T G 2: 164,608,869 probably benign Het
Zfp64 A C 2: 168,926,318 V458G probably benign Het
Zfp868 C T 8: 69,611,868 G272D probably damaging Het
Other mutations in Tuba8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:Tuba8 APN 6 121220511 missense probably benign
IGL02725:Tuba8 APN 6 121225957 nonsense probably null
IGL03091:Tuba8 APN 6 121220444 missense probably damaging 1.00
IGL03286:Tuba8 APN 6 121222954 missense possibly damaging 0.67
R0032:Tuba8 UTSW 6 121225904 missense probably benign 0.37
R1424:Tuba8 UTSW 6 121220511 missense probably benign
R1624:Tuba8 UTSW 6 121220426 missense probably damaging 1.00
R1985:Tuba8 UTSW 6 121220520 missense probably benign 0.00
R2513:Tuba8 UTSW 6 121225973 missense probably damaging 1.00
R3160:Tuba8 UTSW 6 121222738 missense possibly damaging 0.80
R3162:Tuba8 UTSW 6 121222738 missense possibly damaging 0.80
R4074:Tuba8 UTSW 6 121222797 missense probably damaging 1.00
R4875:Tuba8 UTSW 6 121226083 utr 3 prime probably benign
R4968:Tuba8 UTSW 6 121220589 missense probably damaging 1.00
R5073:Tuba8 UTSW 6 121222903 missense probably damaging 0.99
R5444:Tuba8 UTSW 6 121226101 utr 3 prime probably benign
R5546:Tuba8 UTSW 6 121222913 nonsense probably null
R5594:Tuba8 UTSW 6 121225904 missense possibly damaging 0.82
R5619:Tuba8 UTSW 6 121225895 missense probably damaging 0.96
R7366:Tuba8 UTSW 6 121222912 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCGTTTGGGCATTAACCACTTC -3'
(R):5'- AGTTGTAAGGCTCCACCACTGCTG -3'

Sequencing Primer
(F):5'- TGGGCTAATACGATTTCTCTGAC -3'
(R):5'- CACTGCTGTGGAGACCTG -3'
Posted On2014-05-23