Incidental Mutation 'R1742:Pigr'
ID200392
Institutional Source Beutler Lab
Gene Symbol Pigr
Ensembl Gene ENSMUSG00000026417
Gene Namepolymeric immunoglobulin receptor
Synonyms
MMRRC Submission 039774-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1742 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location130826684-130852249 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130845086 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 347 (E347G)
Ref Sequence ENSEMBL: ENSMUSP00000027675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027675] [ENSMUST00000133792] [ENSMUST00000137782]
PDB Structure
Crystal structure of the 1st Ig domain from mouse Polymeric Immunoglobulin receptor [PSI-NYSGRC-006220] [X-RAY DIFFRACTION]
Crystal structure of the second Ig domain from mouse Polymeric Immunoglobulin receptor [PSI-NYSGRC-006220] [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027675
AA Change: E347G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027675
Gene: ENSMUSG00000026417
AA Change: E347G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 128 1.6e-8 SMART
IG 137 238 8.1e-8 SMART
IG 242 346 1.4e-3 SMART
IG 355 457 3.1e-5 SMART
IG 469 563 1e-10 SMART
IG_like 483 548 8e-3 SMART
low complexity region 627 644 N/A INTRINSIC
transmembrane domain 646 668 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133792
SMART Domains Protein: ENSMUSP00000121686
Gene: ENSMUSG00000026417

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 128 1.6e-8 SMART
Blast:IG 137 210 3e-47 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137782
SMART Domains Protein: ENSMUSP00000114334
Gene: ENSMUSG00000026417

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 128 3.91e-6 SMART
Blast:IG 137 201 4e-40 BLAST
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily. The encoded poly-Ig receptor binds polymeric immunoglobulin molecules at the basolateral surface of epithelial cells; the complex is then transported across the cell to be secreted at the apical surface. A significant association was found between immunoglobulin A nephropathy and several SNPs in this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Nullizygous mice show impaired transepithelial transport of dimeric IgA, increased serum IgA levels and mucosal leakiness. Studies of one null allele show increased susceptibility to mycobacterial infections while another allele causes impaired clearanceof the protozoan parasite Giardia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,740,395 probably null Het
Ankhd1 C A 18: 36,625,265 A1004E probably damaging Het
Arfgef2 A G 2: 166,866,980 S1071G probably damaging Het
Arhgef5 T A 6: 43,280,199 I1228N probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bptf A G 11: 107,110,951 V445A probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Bves C T 10: 45,347,865 T207M probably damaging Het
Ccdc171 T A 4: 83,681,284 S779T probably damaging Het
Ccdc54 T C 16: 50,590,238 K222E possibly damaging Het
Cebpe A G 14: 54,711,600 V120A probably benign Het
Clhc1 T A 11: 29,557,647 probably null Het
Col22a1 C T 15: 71,801,913 G985S unknown Het
Col6a3 T A 1: 90,813,794 I639F probably damaging Het
Cryga C A 1: 65,103,121 V38L probably benign Het
Dll3 T C 7: 28,294,423 T530A probably benign Het
Dnah7a G A 1: 53,456,684 P3205S probably benign Het
Dpp10 T A 1: 123,445,206 Y224F probably damaging Het
Fcrls T C 3: 87,259,043 T142A possibly damaging Het
Fyttd1 C T 16: 32,905,553 R175* probably null Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm11487 T C 4: 73,401,210 D99G probably damaging Het
Gm8332 C T 12: 88,249,683 D140N unknown Het
Gpr33 T C 12: 52,024,262 probably null Het
Gse1 T A 8: 120,566,950 V205E probably damaging Het
Herc4 C A 10: 63,287,949 N461K probably benign Het
Ifi206 G A 1: 173,481,971 T153I probably benign Het
Iqca T C 1: 90,098,051 I341V probably benign Het
Itsn1 T G 16: 91,816,959 probably null Het
Kcnk5 T A 14: 20,141,857 Y412F probably benign Het
Lemd1 T A 1: 132,228,298 I26K probably damaging Het
Lipc A T 9: 70,820,529 L12Q probably damaging Het
Lrrtm1 C A 6: 77,244,091 P177Q probably damaging Het
Mcph1 G A 8: 18,607,363 G73R probably benign Het
Myh11 A T 16: 14,220,044 L899Q probably damaging Het
Myo18a G T 11: 77,841,467 R822L probably damaging Het
Nav3 T C 10: 109,769,213 T1000A probably benign Het
Nox4 T C 7: 87,295,818 V94A possibly damaging Het
Olfr1115 T A 2: 87,252,778 N280K probably benign Het
Olfr1230 G T 2: 89,296,424 P282H probably damaging Het
Olfr850 A G 9: 19,478,041 S67P probably damaging Het
Oxr1 T C 15: 41,850,559 L679P probably damaging Het
Pcdhb17 T C 18: 37,486,576 I473T probably damaging Het
Pgbd5 T A 8: 124,380,307 E165D probably damaging Het
Pgpep1l A T 7: 68,237,054 V169D probably damaging Het
Phf12 C T 11: 78,009,486 T136I probably benign Het
Pif1 T A 9: 65,587,850 M14K probably benign Het
Plekha3 G A 2: 76,682,879 E103K possibly damaging Het
Ptgs2 A G 1: 150,104,399 I363V probably damaging Het
Rasl11a T A 5: 146,846,995 probably null Het
Recql T C 6: 142,364,572 T511A probably damaging Het
Rgl2 T A 17: 33,937,223 probably null Het
Rpp25l T C 4: 41,712,763 Y4C probably damaging Het
Sass6 T G 3: 116,607,477 C156G probably damaging Het
Sgta T G 10: 81,046,277 N288T probably damaging Het
Slco1a4 T A 6: 141,825,045 T282S probably benign Het
Smad4 T C 18: 73,675,897 R100G probably damaging Het
Sox8 C T 17: 25,567,941 V263M probably damaging Het
Sp8 A G 12: 118,849,817 H469R probably benign Het
Spata1 A T 3: 146,469,623 probably null Het
Taar7a G A 10: 23,993,219 S88F probably damaging Het
Tnks2 T C 19: 36,876,261 L749S probably damaging Het
Tollip C A 7: 141,892,855 R19L probably damaging Het
Tox2 G A 2: 163,225,526 R55H probably benign Het
Vmn2r27 T C 6: 124,200,677 E456G possibly damaging Het
Vmn2r77 T A 7: 86,795,335 N65K probably benign Het
Vwf T C 6: 125,667,550 M2456T probably benign Het
Zfp526 A G 7: 25,224,514 N66S possibly damaging Het
Zic1 T C 9: 91,361,576 Y446C probably damaging Het
Other mutations in Pigr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Pigr APN 1 130834430 start codon destroyed probably null 1.00
IGL01565:Pigr APN 1 130844474 missense possibly damaging 0.93
IGL01592:Pigr APN 1 130849058 missense probably damaging 1.00
IGL02153:Pigr APN 1 130849056 unclassified probably null
IGL02508:Pigr APN 1 130850858 missense probably benign 0.02
IGL02815:Pigr APN 1 130841821 missense probably damaging 1.00
R0834:Pigr UTSW 1 130844544 nonsense probably null
R1453:Pigr UTSW 1 130841544 missense probably benign 0.00
R1728:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1729:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1730:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1736:Pigr UTSW 1 130841803 missense possibly damaging 0.92
R1739:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1762:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1783:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1784:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1785:Pigr UTSW 1 130844522 missense possibly damaging 0.50
R1929:Pigr UTSW 1 130846662 unclassified probably benign
R2065:Pigr UTSW 1 130850880 missense probably benign 0.20
R2275:Pigr UTSW 1 130846470 missense probably benign 0.00
R2513:Pigr UTSW 1 130846620 missense possibly damaging 0.71
R2910:Pigr UTSW 1 130849533 missense probably damaging 1.00
R2911:Pigr UTSW 1 130849533 missense probably damaging 1.00
R2964:Pigr UTSW 1 130841535 missense probably damaging 1.00
R3857:Pigr UTSW 1 130847261 missense probably benign 0.06
R4165:Pigr UTSW 1 130841817 missense probably benign 0.26
R4166:Pigr UTSW 1 130841817 missense probably benign 0.26
R4303:Pigr UTSW 1 130841817 missense probably benign 0.26
R4735:Pigr UTSW 1 130846554 missense probably damaging 0.99
R4909:Pigr UTSW 1 130848458 missense possibly damaging 0.77
R4993:Pigr UTSW 1 130841817 missense probably benign 0.26
R4994:Pigr UTSW 1 130841817 missense probably benign 0.26
R5033:Pigr UTSW 1 130844699 missense probably damaging 1.00
R5116:Pigr UTSW 1 130849031 missense probably benign 0.00
R5304:Pigr UTSW 1 130849493 missense probably benign 0.00
R5440:Pigr UTSW 1 130849622 splice site probably null
R5853:Pigr UTSW 1 130846604 nonsense probably null
R5934:Pigr UTSW 1 130844527 missense probably damaging 0.98
R6015:Pigr UTSW 1 130847261 missense probably benign 0.06
R6291:Pigr UTSW 1 130841761 missense probably benign 0.06
R6749:Pigr UTSW 1 130846548 missense probably benign 0.14
R6941:Pigr UTSW 1 130847327 missense probably damaging 1.00
R7369:Pigr UTSW 1 130841766 missense probably benign 0.00
R7391:Pigr UTSW 1 130849566 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAAACGAGGCCAAATATCTGTG -3'
(R):5'- TCTGGCTCGCCTAAACTGCATC -3'

Sequencing Primer
(F):5'- CCAAATATCTGTGCCGGATGAATAAG -3'
(R):5'- TCATGGAACACATCAGAGGG -3'
Posted On2014-05-23