Incidental Mutation 'R1742:Ankhd1'
ID200466
Institutional Source Beutler Lab
Gene Symbol Ankhd1
Ensembl Gene ENSMUSG00000024483
Gene Nameankyrin repeat and KH domain containing 1
Synonyms
MMRRC Submission 039774-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R1742 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36559987-36665917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36625265 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 1004 (A1004E)
Ref Sequence ENSEMBL: ENSMUSP00000123270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006205] [ENSMUST00000142977] [ENSMUST00000155329]
Predicted Effect probably damaging
Transcript: ENSMUST00000006205
AA Change: A1004E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006205
Gene: ENSMUSG00000024483
AA Change: A1004E

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136030
SMART Domains Protein: ENSMUSP00000115837
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
ANK 94 123 2.07e-2 SMART
ANK 127 156 2.48e-5 SMART
ANK 161 190 3.85e-2 SMART
ANK 194 219 4.23e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142780
Predicted Effect probably damaging
Transcript: ENSMUST00000142977
AA Change: A1004E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483
AA Change: A1004E

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152060
SMART Domains Protein: ENSMUSP00000116047
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
ANK 1 28 1.6e1 SMART
ANK 32 61 4.56e-4 SMART
ANK 66 95 9.64e-3 SMART
ANK 99 128 6.71e-2 SMART
coiled coil region 227 267 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155329
AA Change: A1004E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123270
Gene: ENSMUSG00000024483
AA Change: A1004E

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2342 2362 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156424
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,740,395 probably null Het
Arfgef2 A G 2: 166,866,980 S1071G probably damaging Het
Arhgef5 T A 6: 43,280,199 I1228N probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bptf A G 11: 107,110,951 V445A probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Bves C T 10: 45,347,865 T207M probably damaging Het
Ccdc171 T A 4: 83,681,284 S779T probably damaging Het
Ccdc54 T C 16: 50,590,238 K222E possibly damaging Het
Cebpe A G 14: 54,711,600 V120A probably benign Het
Clhc1 T A 11: 29,557,647 probably null Het
Col22a1 C T 15: 71,801,913 G985S unknown Het
Col6a3 T A 1: 90,813,794 I639F probably damaging Het
Cryga C A 1: 65,103,121 V38L probably benign Het
Dll3 T C 7: 28,294,423 T530A probably benign Het
Dnah7a G A 1: 53,456,684 P3205S probably benign Het
Dpp10 T A 1: 123,445,206 Y224F probably damaging Het
Fcrls T C 3: 87,259,043 T142A possibly damaging Het
Fyttd1 C T 16: 32,905,553 R175* probably null Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm11487 T C 4: 73,401,210 D99G probably damaging Het
Gm8332 C T 12: 88,249,683 D140N unknown Het
Gpr33 T C 12: 52,024,262 probably null Het
Gse1 T A 8: 120,566,950 V205E probably damaging Het
Herc4 C A 10: 63,287,949 N461K probably benign Het
Ifi206 G A 1: 173,481,971 T153I probably benign Het
Iqca T C 1: 90,098,051 I341V probably benign Het
Itsn1 T G 16: 91,816,959 probably null Het
Kcnk5 T A 14: 20,141,857 Y412F probably benign Het
Lemd1 T A 1: 132,228,298 I26K probably damaging Het
Lipc A T 9: 70,820,529 L12Q probably damaging Het
Lrrtm1 C A 6: 77,244,091 P177Q probably damaging Het
Mcph1 G A 8: 18,607,363 G73R probably benign Het
Myh11 A T 16: 14,220,044 L899Q probably damaging Het
Myo18a G T 11: 77,841,467 R822L probably damaging Het
Nav3 T C 10: 109,769,213 T1000A probably benign Het
Nox4 T C 7: 87,295,818 V94A possibly damaging Het
Olfr1115 T A 2: 87,252,778 N280K probably benign Het
Olfr1230 G T 2: 89,296,424 P282H probably damaging Het
Olfr850 A G 9: 19,478,041 S67P probably damaging Het
Oxr1 T C 15: 41,850,559 L679P probably damaging Het
Pcdhb17 T C 18: 37,486,576 I473T probably damaging Het
Pgbd5 T A 8: 124,380,307 E165D probably damaging Het
Pgpep1l A T 7: 68,237,054 V169D probably damaging Het
Phf12 C T 11: 78,009,486 T136I probably benign Het
Pif1 T A 9: 65,587,850 M14K probably benign Het
Pigr A G 1: 130,845,086 E347G probably damaging Het
Plekha3 G A 2: 76,682,879 E103K possibly damaging Het
Ptgs2 A G 1: 150,104,399 I363V probably damaging Het
Rasl11a T A 5: 146,846,995 probably null Het
Recql T C 6: 142,364,572 T511A probably damaging Het
Rgl2 T A 17: 33,937,223 probably null Het
Rpp25l T C 4: 41,712,763 Y4C probably damaging Het
Sass6 T G 3: 116,607,477 C156G probably damaging Het
Sgta T G 10: 81,046,277 N288T probably damaging Het
Slco1a4 T A 6: 141,825,045 T282S probably benign Het
Smad4 T C 18: 73,675,897 R100G probably damaging Het
Sox8 C T 17: 25,567,941 V263M probably damaging Het
Sp8 A G 12: 118,849,817 H469R probably benign Het
Spata1 A T 3: 146,469,623 probably null Het
Taar7a G A 10: 23,993,219 S88F probably damaging Het
Tnks2 T C 19: 36,876,261 L749S probably damaging Het
Tollip C A 7: 141,892,855 R19L probably damaging Het
Tox2 G A 2: 163,225,526 R55H probably benign Het
Vmn2r27 T C 6: 124,200,677 E456G possibly damaging Het
Vmn2r77 T A 7: 86,795,335 N65K probably benign Het
Vwf T C 6: 125,667,550 M2456T probably benign Het
Zfp526 A G 7: 25,224,514 N66S possibly damaging Het
Zic1 T C 9: 91,361,576 Y446C probably damaging Het
Other mutations in Ankhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ankhd1 APN 18 36665459 unclassified probably benign
IGL00927:Ankhd1 APN 18 36632072 missense probably benign 0.01
IGL01367:Ankhd1 APN 18 36578643 missense probably benign 0.16
IGL01624:Ankhd1 APN 18 36658013 missense probably damaging 1.00
IGL01725:Ankhd1 APN 18 36648153 missense probably benign 0.04
IGL01767:Ankhd1 APN 18 36648374 missense probably damaging 1.00
IGL02005:Ankhd1 APN 18 36648426 missense probably damaging 1.00
IGL02009:Ankhd1 APN 18 36624661 missense probably damaging 1.00
IGL02246:Ankhd1 APN 18 36656726 missense probably damaging 1.00
IGL02336:Ankhd1 APN 18 36594814 missense probably damaging 0.97
IGL02628:Ankhd1 APN 18 36647703 missense probably benign 0.00
IGL02644:Ankhd1 APN 18 36578775 critical splice donor site probably null
IGL02735:Ankhd1 APN 18 36648546 missense probably benign 0.00
IGL02877:Ankhd1 APN 18 36594823 missense probably damaging 1.00
IGL03129:Ankhd1 APN 18 36658008 nonsense probably null
IGL03163:Ankhd1 APN 18 36647628 missense probably damaging 0.97
IGL03182:Ankhd1 APN 18 36578774 missense probably benign 0.06
IGL03184:Ankhd1 APN 18 36647777 missense probably damaging 1.00
IGL03398:Ankhd1 APN 18 36656837 splice site probably benign
FR4304:Ankhd1 UTSW 18 36560924 small insertion probably benign
R0051:Ankhd1 UTSW 18 36647188 unclassified probably benign
R0089:Ankhd1 UTSW 18 36640356 missense probably damaging 0.99
R0105:Ankhd1 UTSW 18 36646766 missense probably damaging 1.00
R0149:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0243:Ankhd1 UTSW 18 36634734 missense probably damaging 1.00
R0322:Ankhd1 UTSW 18 36658008 nonsense probably null
R0361:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0389:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0418:Ankhd1 UTSW 18 36634300 missense probably damaging 1.00
R0443:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0540:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0607:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0738:Ankhd1 UTSW 18 36645249 splice site probably benign
R1127:Ankhd1 UTSW 18 36634346 missense probably damaging 1.00
R1434:Ankhd1 UTSW 18 36625159 missense probably benign 0.09
R1776:Ankhd1 UTSW 18 36647308 missense probably benign 0.17
R1856:Ankhd1 UTSW 18 36644527 missense probably benign 0.00
R1923:Ankhd1 UTSW 18 36648030 missense probably benign 0.08
R2044:Ankhd1 UTSW 18 36645113 missense probably benign 0.31
R2112:Ankhd1 UTSW 18 36641626 missense probably damaging 1.00
R2115:Ankhd1 UTSW 18 36634308 missense probably damaging 1.00
R2136:Ankhd1 UTSW 18 36647621 missense probably benign
R2196:Ankhd1 UTSW 18 36648379 missense probably damaging 1.00
R2291:Ankhd1 UTSW 18 36644333 missense probably benign 0.31
R2305:Ankhd1 UTSW 18 36642926 missense possibly damaging 0.59
R2309:Ankhd1 UTSW 18 36624765 missense probably damaging 1.00
R2519:Ankhd1 UTSW 18 36578543 intron probably null
R2958:Ankhd1 UTSW 18 36634729 missense probably damaging 1.00
R3978:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R3980:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R4159:Ankhd1 UTSW 18 36589540 missense possibly damaging 0.91
R4199:Ankhd1 UTSW 18 36661048 unclassified probably benign
R4323:Ankhd1 UTSW 18 36578633 missense probably damaging 1.00
R4356:Ankhd1 UTSW 18 36643043 nonsense probably null
R4496:Ankhd1 UTSW 18 36560786 missense probably damaging 0.98
R4551:Ankhd1 UTSW 18 36655507 unclassified probably null
R4590:Ankhd1 UTSW 18 36583644 missense probably damaging 1.00
R4667:Ankhd1 UTSW 18 36648021 missense possibly damaging 0.77
R4889:Ankhd1 UTSW 18 36578734 missense probably null 0.00
R4923:Ankhd1 UTSW 18 36589452 missense probably damaging 1.00
R5091:Ankhd1 UTSW 18 36625027 missense possibly damaging 0.68
R5254:Ankhd1 UTSW 18 36656715 missense probably benign 0.05
R5314:Ankhd1 UTSW 18 36561058 splice site probably null
R5336:Ankhd1 UTSW 18 36646716 missense probably damaging 1.00
R5367:Ankhd1 UTSW 18 36589408 missense probably damaging 1.00
R5384:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5385:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5387:Ankhd1 UTSW 18 36634644 missense probably damaging 1.00
R5458:Ankhd1 UTSW 18 36648485 missense probably benign 0.01
R5599:Ankhd1 UTSW 18 36560807 missense probably damaging 0.98
R5659:Ankhd1 UTSW 18 36561050 missense probably damaging 1.00
R5750:Ankhd1 UTSW 18 36624902 missense probably benign 0.00
R5874:Ankhd1 UTSW 18 36640269 missense possibly damaging 0.92
R5894:Ankhd1 UTSW 18 36647524 missense probably damaging 0.99
R5969:Ankhd1 UTSW 18 36600834 missense probably damaging 1.00
R6133:Ankhd1 UTSW 18 36625126 missense possibly damaging 0.77
R6190:Ankhd1 UTSW 18 36611809 missense possibly damaging 0.84
R6247:Ankhd1 UTSW 18 36654146 missense probably benign 0.00
R6512:Ankhd1 UTSW 18 36591456 missense probably damaging 1.00
R6649:Ankhd1 UTSW 18 36600783 unclassified probably null
R6653:Ankhd1 UTSW 18 36600783 unclassified probably null
R6763:Ankhd1 UTSW 18 36642969 missense probably benign 0.31
R6976:Ankhd1 UTSW 18 36648254 missense probably benign 0.00
X0027:Ankhd1 UTSW 18 36624832 missense probably damaging 1.00
X0065:Ankhd1 UTSW 18 36578764 nonsense probably null
X0066:Ankhd1 UTSW 18 36646704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCACCATCGGCAGAACAAATTG -3'
(R):5'- TGTCCAAGCATGAAATTCATTGGCAAG -3'

Sequencing Primer
(F):5'- GAACAAATTGACTTTGTCCCAGTCC -3'
(R):5'- GGGAAACACCCATAATGTGC -3'
Posted On2014-05-23