Incidental Mutation 'R1742:Pcdhb17'
ID200467
Institutional Source Beutler Lab
Gene Symbol Pcdhb17
Ensembl Gene ENSMUSG00000046387
Gene Nameprotocadherin beta 17
SynonymsPcdhbQ, Pcdhb16
MMRRC Submission 039774-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1742 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37484795-37489454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37486576 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 473 (I473T)
Ref Sequence ENSEMBL: ENSMUSP00000055072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051442] [ENSMUST00000053856] [ENSMUST00000055949] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000051442
SMART Domains Protein: ENSMUSP00000056347
Gene: ENSMUSG00000047910

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 46 132 7.7e-1 SMART
CA 156 241 1.93e-17 SMART
CA 265 346 4.2e-27 SMART
CA 369 450 1.08e-24 SMART
CA 474 560 3.31e-25 SMART
CA 590 671 2.87e-11 SMART
Pfam:Cadherin_C_2 687 770 4.1e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000053856
AA Change: I473T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055072
Gene: ENSMUSG00000046387
AA Change: I473T

DomainStartEndE-ValueType
Pfam:Cadherin_2 31 112 5.8e-35 PFAM
CA 155 240 2.42e-18 SMART
CA 264 345 8.03e-24 SMART
CA 368 449 5.81e-21 SMART
CA 473 559 8.15e-25 SMART
CA 589 670 6.34e-13 SMART
Pfam:Cadherin_C_2 686 770 1.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055949
SMART Domains Protein: ENSMUSP00000052113
Gene: ENSMUSG00000048347

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Cadherin_2 30 112 3.1e-34 PFAM
CA 155 240 7.97e-19 SMART
CA 264 345 6.27e-26 SMART
CA 368 449 2.63e-19 SMART
CA 473 559 7.09e-25 SMART
CA 589 670 2.87e-11 SMART
Pfam:Cadherin_C_2 687 771 7.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,740,395 probably null Het
Ankhd1 C A 18: 36,625,265 A1004E probably damaging Het
Arfgef2 A G 2: 166,866,980 S1071G probably damaging Het
Arhgef5 T A 6: 43,280,199 I1228N probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bptf A G 11: 107,110,951 V445A probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Bves C T 10: 45,347,865 T207M probably damaging Het
Ccdc171 T A 4: 83,681,284 S779T probably damaging Het
Ccdc54 T C 16: 50,590,238 K222E possibly damaging Het
Cebpe A G 14: 54,711,600 V120A probably benign Het
Clhc1 T A 11: 29,557,647 probably null Het
Col22a1 C T 15: 71,801,913 G985S unknown Het
Col6a3 T A 1: 90,813,794 I639F probably damaging Het
Cryga C A 1: 65,103,121 V38L probably benign Het
Dll3 T C 7: 28,294,423 T530A probably benign Het
Dnah7a G A 1: 53,456,684 P3205S probably benign Het
Dpp10 T A 1: 123,445,206 Y224F probably damaging Het
Fcrls T C 3: 87,259,043 T142A possibly damaging Het
Fyttd1 C T 16: 32,905,553 R175* probably null Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm11487 T C 4: 73,401,210 D99G probably damaging Het
Gm8332 C T 12: 88,249,683 D140N unknown Het
Gpr33 T C 12: 52,024,262 probably null Het
Gse1 T A 8: 120,566,950 V205E probably damaging Het
Herc4 C A 10: 63,287,949 N461K probably benign Het
Ifi206 G A 1: 173,481,971 T153I probably benign Het
Iqca T C 1: 90,098,051 I341V probably benign Het
Itsn1 T G 16: 91,816,959 probably null Het
Kcnk5 T A 14: 20,141,857 Y412F probably benign Het
Lemd1 T A 1: 132,228,298 I26K probably damaging Het
Lipc A T 9: 70,820,529 L12Q probably damaging Het
Lrrtm1 C A 6: 77,244,091 P177Q probably damaging Het
Mcph1 G A 8: 18,607,363 G73R probably benign Het
Myh11 A T 16: 14,220,044 L899Q probably damaging Het
Myo18a G T 11: 77,841,467 R822L probably damaging Het
Nav3 T C 10: 109,769,213 T1000A probably benign Het
Nox4 T C 7: 87,295,818 V94A possibly damaging Het
Olfr1115 T A 2: 87,252,778 N280K probably benign Het
Olfr1230 G T 2: 89,296,424 P282H probably damaging Het
Olfr850 A G 9: 19,478,041 S67P probably damaging Het
Oxr1 T C 15: 41,850,559 L679P probably damaging Het
Pgbd5 T A 8: 124,380,307 E165D probably damaging Het
Pgpep1l A T 7: 68,237,054 V169D probably damaging Het
Phf12 C T 11: 78,009,486 T136I probably benign Het
Pif1 T A 9: 65,587,850 M14K probably benign Het
Pigr A G 1: 130,845,086 E347G probably damaging Het
Plekha3 G A 2: 76,682,879 E103K possibly damaging Het
Ptgs2 A G 1: 150,104,399 I363V probably damaging Het
Rasl11a T A 5: 146,846,995 probably null Het
Recql T C 6: 142,364,572 T511A probably damaging Het
Rgl2 T A 17: 33,937,223 probably null Het
Rpp25l T C 4: 41,712,763 Y4C probably damaging Het
Sass6 T G 3: 116,607,477 C156G probably damaging Het
Sgta T G 10: 81,046,277 N288T probably damaging Het
Slco1a4 T A 6: 141,825,045 T282S probably benign Het
Smad4 T C 18: 73,675,897 R100G probably damaging Het
Sox8 C T 17: 25,567,941 V263M probably damaging Het
Sp8 A G 12: 118,849,817 H469R probably benign Het
Spata1 A T 3: 146,469,623 probably null Het
Taar7a G A 10: 23,993,219 S88F probably damaging Het
Tnks2 T C 19: 36,876,261 L749S probably damaging Het
Tollip C A 7: 141,892,855 R19L probably damaging Het
Tox2 G A 2: 163,225,526 R55H probably benign Het
Vmn2r27 T C 6: 124,200,677 E456G possibly damaging Het
Vmn2r77 T A 7: 86,795,335 N65K probably benign Het
Vwf T C 6: 125,667,550 M2456T probably benign Het
Zfp526 A G 7: 25,224,514 N66S possibly damaging Het
Zic1 T C 9: 91,361,576 Y446C probably damaging Het
Other mutations in Pcdhb17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Pcdhb17 APN 18 37486006 unclassified probably null
IGL01367:Pcdhb17 APN 18 37487495 missense probably benign 0.01
IGL01923:Pcdhb17 APN 18 37486737 missense probably benign 0.43
IGL02060:Pcdhb17 APN 18 37486416 missense probably damaging 1.00
IGL02494:Pcdhb17 APN 18 37485294 missense possibly damaging 0.73
IGL02654:Pcdhb17 APN 18 37486561 missense probably benign 0.03
IGL03168:Pcdhb17 APN 18 37485772 missense probably benign 0.15
doughnut UTSW 18 37486936 missense probably damaging 1.00
miniscule UTSW 18 37485667 missense probably damaging 1.00
PIT4434001:Pcdhb17 UTSW 18 37485651 missense probably damaging 1.00
R0364:Pcdhb17 UTSW 18 37485835 missense possibly damaging 0.95
R1013:Pcdhb17 UTSW 18 37485967 missense probably damaging 1.00
R1052:Pcdhb17 UTSW 18 37486846 missense probably damaging 1.00
R1226:Pcdhb17 UTSW 18 37487260 missense probably damaging 1.00
R1258:Pcdhb17 UTSW 18 37485534 missense probably damaging 0.98
R1335:Pcdhb17 UTSW 18 37486234 missense probably damaging 1.00
R1443:Pcdhb17 UTSW 18 37486648 missense probably benign 0.15
R1451:Pcdhb17 UTSW 18 37486936 missense probably damaging 1.00
R1505:Pcdhb17 UTSW 18 37486822 missense probably damaging 1.00
R1591:Pcdhb17 UTSW 18 37485825 missense probably damaging 1.00
R1750:Pcdhb17 UTSW 18 37485711 missense probably damaging 1.00
R1750:Pcdhb17 UTSW 18 37487017 missense possibly damaging 0.81
R1764:Pcdhb17 UTSW 18 37487271 missense probably damaging 1.00
R1863:Pcdhb17 UTSW 18 37486111 missense probably benign 0.00
R1888:Pcdhb17 UTSW 18 37487385 unclassified probably null
R1888:Pcdhb17 UTSW 18 37487385 unclassified probably null
R2095:Pcdhb17 UTSW 18 37486322 missense probably benign 0.14
R4565:Pcdhb17 UTSW 18 37486470 missense probably benign 0.14
R4658:Pcdhb17 UTSW 18 37486599 missense probably damaging 1.00
R4669:Pcdhb17 UTSW 18 37486206 missense probably damaging 0.99
R4816:Pcdhb17 UTSW 18 37487397 missense probably benign 0.39
R4910:Pcdhb17 UTSW 18 37485159 start codon destroyed possibly damaging 0.90
R5209:Pcdhb17 UTSW 18 37487461 missense probably damaging 1.00
R5248:Pcdhb17 UTSW 18 37485886 missense probably benign 0.00
R5254:Pcdhb17 UTSW 18 37486825 missense probably damaging 1.00
R5494:Pcdhb17 UTSW 18 37487247 missense probably damaging 1.00
R5544:Pcdhb17 UTSW 18 37487421 missense possibly damaging 0.61
R5952:Pcdhb17 UTSW 18 37487080 missense probably benign 0.04
R5977:Pcdhb17 UTSW 18 37485667 missense probably damaging 1.00
R6262:Pcdhb17 UTSW 18 37486698 missense probably damaging 1.00
R6311:Pcdhb17 UTSW 18 37486263 unclassified probably null
R6495:Pcdhb17 UTSW 18 37485667 missense probably damaging 1.00
R6710:Pcdhb17 UTSW 18 37485399 missense probably damaging 0.96
R7097:Pcdhb17 UTSW 18 37486513 missense probably benign
R7122:Pcdhb17 UTSW 18 37486513 missense probably benign
R7130:Pcdhb17 UTSW 18 37485445 missense probably damaging 1.00
R7437:Pcdhb17 UTSW 18 37486092 missense probably benign 0.01
X0062:Pcdhb17 UTSW 18 37486489 missense probably benign
X0064:Pcdhb17 UTSW 18 37486431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGATGCTATCTGCTCTTACCAGCC -3'
(R):5'- TGAGCCTTGGTCTATTGCACCCAC -3'

Sequencing Primer
(F):5'- TGATTGCCTCCATCGAAGAAG -3'
(R):5'- GTTGATGGAGATGAGCGAGT -3'
Posted On2014-05-23