Incidental Mutation 'R0089:Lrpap1'
ID20048
Institutional Source Beutler Lab
Gene Symbol Lrpap1
Ensembl Gene ENSMUSG00000029103
Gene Namelow density lipoprotein receptor-related protein associated protein 1
SynonymsRAP
MMRRC Submission 038376-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0089 (G1)
Quality Score225
Status Validated (trace)
Chromosome5
Chromosomal Location35091501-35105766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35094888 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 328 (V328M)
Ref Sequence ENSEMBL: ENSMUSP00000030986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030986]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030986
AA Change: V328M

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030986
Gene: ENSMUSG00000029103
AA Change: V328M

DomainStartEndE-ValueType
Pfam:Alpha-2-MRAP_N 20 137 7.7e-45 PFAM
Pfam:Alpha-2-MRAP_C 148 360 3.4e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147028
Predicted Effect unknown
Transcript: ENSMUST00000153664
AA Change: V120M
SMART Domains Protein: ENSMUSP00000120233
Gene: ENSMUSG00000029103
AA Change: V120M

DomainStartEndE-ValueType
Pfam:Alpha-2-MRAP_C 2 153 4.7e-48 PFAM
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the low density lipoprotein (LDL) receptor-related protein and facilitates its proper folding and localization by preventing the binding of ligands. Mutations in this gene have been identified in individuals with myopia 23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. However, subtle abnormalities are seen in behavior, brain function and thyroid function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,292,886 V1583E possibly damaging Het
Ablim1 G T 19: 57,043,031 S654Y probably damaging Het
Acbd4 T C 11: 103,103,993 F59S probably damaging Het
Acot1 T C 12: 84,016,934 I272T probably damaging Het
Ankhd1 A G 18: 36,640,356 D1402G probably damaging Het
Birc6 T A 17: 74,638,376 F2800I possibly damaging Het
Brd1 T C 15: 88,701,198 E811G probably benign Het
Ccdc106 A G 7: 5,056,221 probably null Het
Ccdc81 G T 7: 89,893,116 A184E possibly damaging Het
Cenpt T C 8: 105,846,368 T364A probably benign Het
Crybg2 T C 4: 134,081,194 S1060P probably damaging Het
Dnttip2 A G 3: 122,275,462 T109A possibly damaging Het
Dpy19l2 A G 9: 24,695,793 L124P probably benign Het
Fat3 T C 9: 15,938,205 D3967G probably benign Het
Fbxo21 T A 5: 118,008,143 F610L probably benign Het
Fmo9 T C 1: 166,667,309 D341G probably benign Het
Frem3 A T 8: 80,615,878 H1600L possibly damaging Het
Fry A T 5: 150,340,427 K133N possibly damaging Het
Gm10647 A G 9: 66,798,330 probably benign Het
Gm13124 T A 4: 144,555,733 H163L probably benign Het
Gm16432 C T 1: 178,046,989 P141S unknown Het
Gm21319 A T 12: 87,773,513 I92N probably damaging Het
Gmps T C 3: 63,998,698 F472S probably benign Het
Grb10 T C 11: 11,934,192 probably benign Het
Grm6 G A 11: 50,859,965 G652S probably damaging Het
Heca G T 10: 17,908,100 D468E probably damaging Het
Heg1 C T 16: 33,763,615 S1033L probably damaging Het
Hepacam2 A G 6: 3,487,094 S12P probably damaging Het
Impdh1 G T 6: 29,206,326 H195N probably benign Het
Ipo7 T C 7: 110,050,765 probably benign Het
Itpr2 C T 6: 146,350,022 probably null Het
Kcnh6 G A 11: 106,009,022 C39Y probably benign Het
Kif26a T C 12: 112,177,403 S1364P probably damaging Het
Lins1 T A 7: 66,712,048 probably benign Het
Lyn T G 4: 3,748,768 L249V probably benign Het
Mpp7 A G 18: 7,439,555 probably benign Het
Mtmr9 A G 14: 63,528,247 F400L possibly damaging Het
Mto1 G A 9: 78,473,872 S666N probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nsg1 T C 5: 38,155,630 E75G probably benign Het
Nsun4 A G 4: 116,035,773 M283T probably benign Het
Obscn A G 11: 59,000,062 S7215P unknown Het
Olfr1042 A C 2: 86,159,574 S265R possibly damaging Het
Olfr1160 T C 2: 88,005,987 I264V probably damaging Het
Olfr1383 G A 11: 49,524,206 S161N possibly damaging Het
Olfr340 G A 2: 36,453,095 R170K probably benign Het
Olfr53 T C 7: 140,652,311 S111P probably damaging Het
Olfr677 T A 7: 105,057,090 Y281* probably null Het
Olfr736 T C 14: 50,392,864 I36T probably benign Het
Per1 T C 11: 69,104,043 F563S probably benign Het
Pik3c3 T A 18: 30,303,078 probably benign Het
Pitrm1 A T 13: 6,555,639 K207N probably damaging Het
Prdm10 C T 9: 31,316,230 R44C probably damaging Het
Rab40c A T 17: 25,885,148 I90N probably damaging Het
Rbl1 A G 2: 157,199,414 probably null Het
Rnf17 G A 14: 56,514,106 G1467E probably damaging Het
Rpgrip1 A G 14: 52,149,384 probably benign Het
Sall1 A T 8: 89,030,268 N1069K probably benign Het
Scap T C 9: 110,372,222 I93T possibly damaging Het
Sez6 T C 11: 77,974,344 probably benign Het
Slc22a30 A T 19: 8,370,197 S280T probably benign Het
Slc26a5 A C 5: 21,811,344 probably null Het
St18 T C 1: 6,848,948 V901A probably benign Het
Syne2 T C 12: 75,963,876 L2519P probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tmem51 T C 4: 142,031,925 T171A probably benign Het
Tns4 A T 11: 99,075,198 I453N probably damaging Het
Trank1 A T 9: 111,392,910 H2905L probably benign Het
Trim13 C T 14: 61,604,717 T61I possibly damaging Het
Trim75 T C 8: 64,982,928 Q290R possibly damaging Het
Ttn C A 2: 76,729,200 R29619L probably damaging Het
Ugt2b38 T A 5: 87,420,558 M293L probably benign Het
Vmn1r22 T A 6: 57,900,528 N155Y probably benign Het
Vmn2r18 T C 5: 151,584,804 Y285C probably benign Het
Vmn2r84 C T 10: 130,386,719 probably benign Het
Vwde A C 6: 13,220,005 L49R probably damaging Het
Yipf2 T A 9: 21,591,966 E68D possibly damaging Het
Zfand5 C A 19: 21,279,758 probably benign Het
Other mutations in Lrpap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02219:Lrpap1 APN 5 35096067 splice site probably benign
IGL03102:Lrpap1 APN 5 35093350 missense probably damaging 0.98
R0029:Lrpap1 UTSW 5 35097677 missense possibly damaging 0.86
R1944:Lrpap1 UTSW 5 35097630 missense probably benign 0.00
R1955:Lrpap1 UTSW 5 35102412 missense probably damaging 1.00
R3877:Lrpap1 UTSW 5 35098203 missense probably benign 0.04
R4004:Lrpap1 UTSW 5 35105544 nonsense probably null
R4077:Lrpap1 UTSW 5 35096037 missense possibly damaging 0.74
R4078:Lrpap1 UTSW 5 35096037 missense possibly damaging 0.74
R4079:Lrpap1 UTSW 5 35096037 missense possibly damaging 0.74
R4782:Lrpap1 UTSW 5 35099278 missense probably damaging 0.99
R4828:Lrpap1 UTSW 5 35102421 missense possibly damaging 0.95
R6672:Lrpap1 UTSW 5 35099233 missense probably benign 0.02
R6925:Lrpap1 UTSW 5 35102536 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAATGGACTGCATTTGTGTTTCCC -3'
(R):5'- TCAAAGGTCCCCACTGCTATCAGG -3'

Sequencing Primer
(F):5'- CTGAGTCaggaggtcatgtttg -3'
(R):5'- GGACAATCCCTGTTTAGAGACTCG -3'
Posted On2013-04-11