Incidental Mutation 'R1743:Gm6871'
ID200500
Institutional Source Beutler Lab
Gene Symbol Gm6871
Ensembl Gene ENSMUSG00000090744
Gene Namepredicted gene 6871
Synonyms
MMRRC Submission 039775-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R1743 (G1)
Quality Score128
Status Not validated
Chromosome7
Chromosomal Location41545674-41573662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 41546452 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 287 (T287K)
Ref Sequence ENSEMBL: ENSMUSP00000105843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073410] [ENSMUST00000110214] [ENSMUST00000164677]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073410
AA Change: T180K

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073117
Gene: ENSMUSG00000090744
AA Change: T180K

DomainStartEndE-ValueType
KRAB 4 64 1.19e-16 SMART
ZnF_C2H2 131 153 3.44e-4 SMART
ZnF_C2H2 159 181 5.99e-4 SMART
ZnF_C2H2 187 209 3.34e-2 SMART
ZnF_C2H2 215 237 5.99e-4 SMART
ZnF_C2H2 243 265 1.28e-3 SMART
ZnF_C2H2 271 293 3.69e-4 SMART
ZnF_C2H2 299 321 1.36e-2 SMART
ZnF_C2H2 327 349 3.21e-4 SMART
ZnF_C2H2 355 377 2.61e-4 SMART
ZnF_C2H2 383 405 3.16e-3 SMART
ZnF_C2H2 411 433 5.14e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110214
AA Change: T287K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105843
Gene: ENSMUSG00000090744
AA Change: T287K

DomainStartEndE-ValueType
KRAB 111 171 1.19e-16 SMART
ZnF_C2H2 238 260 3.44e-4 SMART
ZnF_C2H2 266 288 5.99e-4 SMART
ZnF_C2H2 294 316 3.34e-2 SMART
ZnF_C2H2 322 344 5.99e-4 SMART
ZnF_C2H2 350 372 1.28e-3 SMART
ZnF_C2H2 378 400 3.69e-4 SMART
ZnF_C2H2 406 428 1.36e-2 SMART
ZnF_C2H2 434 456 3.21e-4 SMART
ZnF_C2H2 462 484 2.61e-4 SMART
ZnF_C2H2 490 512 3.16e-3 SMART
ZnF_C2H2 518 540 5.14e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000164677
AA Change: H138N

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131240
Gene: ENSMUSG00000090744
AA Change: H138N

DomainStartEndE-ValueType
internal_repeat_1 21 67 6.62e-7 PROSPERO
internal_repeat_1 105 151 6.62e-7 PROSPERO
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff4 T A 11: 53,368,695 M11K possibly damaging Het
Ank2 T C 3: 126,928,675 D88G probably damaging Het
Arhgap32 A G 9: 32,259,431 E1169G probably benign Het
Atp7b A T 8: 22,006,387 V865E probably damaging Het
Bcl2l13 T A 6: 120,848,543 Y13* probably null Het
Birc6 A G 17: 74,579,756 Q693R possibly damaging Het
Bub1 T C 2: 127,813,850 D520G probably damaging Het
Ccdc15 A T 9: 37,277,477 Y770* probably null Het
Cenpf T C 1: 189,654,263 E1940G probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cmya5 A G 13: 93,097,317 V421A probably benign Het
Cnnm1 A T 19: 43,471,913 Y698F possibly damaging Het
Cnst C T 1: 179,610,392 T507I probably benign Het
Coq8a T C 1: 180,182,229 M4V probably benign Het
Csmd3 A G 15: 48,622,089 L140P probably damaging Het
Cul2 A T 18: 3,426,851 I431F probably damaging Het
Dnah8 G T 17: 30,769,651 E3198D probably benign Het
Epn2 T A 11: 61,546,411 I112F possibly damaging Het
Ext2 T C 2: 93,730,225 E532G probably damaging Het
Fndc3a A T 14: 72,652,081 V37E probably damaging Het
Gabbr2 A G 4: 46,677,603 F759S possibly damaging Het
Ghr G A 15: 3,320,241 P485L probably benign Het
Glipr1l2 G T 10: 112,092,565 V122L probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm13128 T C 4: 144,333,005 S429P probably benign Het
Gm7275 A G 16: 48,073,757 noncoding transcript Het
Hephl1 C T 9: 15,090,068 V254I probably damaging Het
Hnf4a C A 2: 163,566,339 Q362K possibly damaging Het
Kcne3 C T 7: 100,184,424 R83C probably damaging Het
Klb C A 5: 65,375,861 N504K probably damaging Het
Loxl2 T A 14: 69,692,402 I743N possibly damaging Het
Lrrc9 A T 12: 72,456,117 L287F probably damaging Het
Mcm3ap C T 10: 76,484,674 P822L possibly damaging Het
Nacc2 T C 2: 26,060,143 N527S probably benign Het
Ncam1 G T 9: 49,557,145 P338H probably damaging Het
Nfkbiz G T 16: 55,816,394 Q515K possibly damaging Het
Nipsnap2 T C 5: 129,757,085 L263P probably damaging Het
Nlrp1a A T 11: 71,124,206 S73T probably benign Het
Nomo1 G A 7: 46,070,037 probably null Het
Nos3 G A 5: 24,377,312 G594D probably benign Het
Olfr1330 A G 4: 118,893,526 T148A probably benign Het
Olfr1359 A G 13: 21,703,450 I150V probably benign Het
Olfr148 A T 9: 39,613,620 T18S possibly damaging Het
Oprm1 A G 10: 6,830,105 I256V probably damaging Het
Oxct2a A T 4: 123,323,516 L24Q possibly damaging Het
Pcdhb14 T G 18: 37,448,178 S112R probably benign Het
Polr2a A G 11: 69,739,503 I1246T probably damaging Het
Ppil4 A T 10: 7,807,381 K327N probably damaging Het
Pstpip1 T C 9: 56,125,930 Y249H probably damaging Het
Qrsl1 A T 10: 43,881,515 V369E probably damaging Het
Ranbp10 G T 8: 105,779,978 P237T probably damaging Het
Rapgef6 A G 11: 54,676,284 N1097S probably damaging Het
Repin1 T A 6: 48,597,750 S538T probably damaging Het
Rims2 A T 15: 39,679,650 M1151L probably benign Het
Rin3 T A 12: 102,390,096 D965E possibly damaging Het
Sdc2 A G 15: 33,028,078 D114G probably benign Het
Slc25a30 C A 14: 75,775,083 A42S probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssh2 T A 11: 77,437,756 F383I probably damaging Het
St8sia1 A T 6: 142,829,016 V279E probably damaging Het
Tacc2 C A 7: 130,626,598 S1690* probably null Het
Taf1b A G 12: 24,547,178 D372G possibly damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem165 G T 5: 76,207,826 G272C probably damaging Het
Tsc22d2 TCAGTTAACACCTATGAACAGT TCAGT 3: 58,417,539 probably null Het
Tssk4 C A 14: 55,651,031 A119D probably damaging Het
Usp9y A G Y: 1,316,727 Y1941H probably damaging Het
Vmn2r42 A T 7: 8,184,265 M786K probably benign Het
Wdfy3 G T 5: 101,844,065 T3470K probably benign Het
Wdr63 C A 3: 146,097,262 R58L possibly damaging Het
Zc3h14 T C 12: 98,779,189 V479A probably benign Het
Zfp821 G A 8: 109,724,164 R263Q probably damaging Het
Other mutations in Gm6871
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Gm6871 APN 7 41546421 missense possibly damaging 0.67
R0419:Gm6871 UTSW 7 41573445 missense probably benign 0.00
R1005:Gm6871 UTSW 7 41546258 missense probably damaging 1.00
R1544:Gm6871 UTSW 7 41546090 unclassified probably null
R1553:Gm6871 UTSW 7 41546398 missense probably benign 0.00
R1674:Gm6871 UTSW 7 41573635 missense possibly damaging 0.46
R1710:Gm6871 UTSW 7 41546477 missense probably damaging 1.00
R1777:Gm6871 UTSW 7 41545719 missense probably benign 0.23
R1844:Gm6871 UTSW 7 41573468 missense probably benign 0.03
R2508:Gm6871 UTSW 7 41547990 missense probably benign 0.11
R2966:Gm6871 UTSW 7 41573440 missense probably benign 0.07
R3155:Gm6871 UTSW 7 41573655 missense probably benign 0.03
R3156:Gm6871 UTSW 7 41573655 missense probably benign 0.03
R3967:Gm6871 UTSW 7 41546724 missense probably damaging 0.99
R4156:Gm6871 UTSW 7 41546086 missense probably damaging 0.96
R4238:Gm6871 UTSW 7 41545780 missense probably damaging 1.00
R4239:Gm6871 UTSW 7 41545780 missense probably damaging 1.00
R4240:Gm6871 UTSW 7 41545780 missense probably damaging 1.00
R4731:Gm6871 UTSW 7 41546749 missense probably benign 0.01
R4732:Gm6871 UTSW 7 41546749 missense probably benign 0.01
R4733:Gm6871 UTSW 7 41546749 missense probably benign 0.01
R4910:Gm6871 UTSW 7 41573592 missense probably benign 0.03
R5269:Gm6871 UTSW 7 41548101 missense probably damaging 0.99
R5371:Gm6871 UTSW 7 41573568 missense probably benign 0.07
R6222:Gm6871 UTSW 7 41546582 missense probably damaging 0.99
R6975:Gm6871 UTSW 7 41546778 synonymous silent
Predicted Primers PCR Primer
(F):5'- CTGGAGAGTACTGTGATGTGCAAAGG -3'
(R):5'- GTCATGCAGGAGAGAAACACTGTGAA -3'

Sequencing Primer
(F):5'- tgactgtgagatacaaatgatttacc -3'
(R):5'- TGCATGTCATAgtagtcttcaaatac -3'
Posted On2014-05-23