Incidental Mutation 'R0089:Fry'
ID20052
Institutional Source Beutler Lab
Gene Symbol Fry
Ensembl Gene ENSMUSG00000056602
Gene NameFRY microtubule binding protein
Synonyms9330186A19Rik, cg003
MMRRC Submission 038376-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.576) question?
Stock #R0089 (G1)
Quality Score225
Status Validated (trace)
Chromosome5
Chromosomal Location150118645-150497753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 150340427 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 133 (K133N)
Ref Sequence ENSEMBL: ENSMUSP00000084454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087204] [ENSMUST00000200960] [ENSMUST00000202530] [ENSMUST00000202600]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087204
AA Change: K133N

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084454
Gene: ENSMUSG00000056602
AA Change: K133N

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 165 697 5.3e-170 PFAM
low complexity region 1014 1040 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1188 1380 1.2e-15 PFAM
Pfam:MOR2-PAG1_mid 1398 1534 1.5e-5 PFAM
Pfam:MOR2-PAG1_mid 1632 1704 1.8e-7 PFAM
Pfam:MOR2-PAG1_mid 1772 1906 4.9e-10 PFAM
low complexity region 1936 1956 N/A INTRINSIC
low complexity region 1962 1980 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2050 2303 1.9e-74 PFAM
low complexity region 2369 2385 N/A INTRINSIC
low complexity region 2463 2482 N/A INTRINSIC
low complexity region 2525 2534 N/A INTRINSIC
low complexity region 2836 2852 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200960
AA Change: K83N

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000202530
AA Change: K83N

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144277
Gene: ENSMUSG00000056602
AA Change: K83N

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 115 159 3.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202600
SMART Domains Protein: ENSMUSP00000144317
Gene: ENSMUSG00000056602

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203000
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (82/84)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,292,886 V1583E possibly damaging Het
Ablim1 G T 19: 57,043,031 S654Y probably damaging Het
Acbd4 T C 11: 103,103,993 F59S probably damaging Het
Acot1 T C 12: 84,016,934 I272T probably damaging Het
Ankhd1 A G 18: 36,640,356 D1402G probably damaging Het
Birc6 T A 17: 74,638,376 F2800I possibly damaging Het
Brd1 T C 15: 88,701,198 E811G probably benign Het
Ccdc106 A G 7: 5,056,221 probably null Het
Ccdc81 G T 7: 89,893,116 A184E possibly damaging Het
Cenpt T C 8: 105,846,368 T364A probably benign Het
Crybg2 T C 4: 134,081,194 S1060P probably damaging Het
Dnttip2 A G 3: 122,275,462 T109A possibly damaging Het
Dpy19l2 A G 9: 24,695,793 L124P probably benign Het
Fat3 T C 9: 15,938,205 D3967G probably benign Het
Fbxo21 T A 5: 118,008,143 F610L probably benign Het
Fmo9 T C 1: 166,667,309 D341G probably benign Het
Frem3 A T 8: 80,615,878 H1600L possibly damaging Het
Gm10647 A G 9: 66,798,330 probably benign Het
Gm13124 T A 4: 144,555,733 H163L probably benign Het
Gm16432 C T 1: 178,046,989 P141S unknown Het
Gm21319 A T 12: 87,773,513 I92N probably damaging Het
Gmps T C 3: 63,998,698 F472S probably benign Het
Grb10 T C 11: 11,934,192 probably benign Het
Grm6 G A 11: 50,859,965 G652S probably damaging Het
Heca G T 10: 17,908,100 D468E probably damaging Het
Heg1 C T 16: 33,763,615 S1033L probably damaging Het
Hepacam2 A G 6: 3,487,094 S12P probably damaging Het
Impdh1 G T 6: 29,206,326 H195N probably benign Het
Ipo7 T C 7: 110,050,765 probably benign Het
Itpr2 C T 6: 146,350,022 probably null Het
Kcnh6 G A 11: 106,009,022 C39Y probably benign Het
Kif26a T C 12: 112,177,403 S1364P probably damaging Het
Lins1 T A 7: 66,712,048 probably benign Het
Lrpap1 C T 5: 35,094,888 V328M possibly damaging Het
Lyn T G 4: 3,748,768 L249V probably benign Het
Mpp7 A G 18: 7,439,555 probably benign Het
Mtmr9 A G 14: 63,528,247 F400L possibly damaging Het
Mto1 G A 9: 78,473,872 S666N probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nsg1 T C 5: 38,155,630 E75G probably benign Het
Nsun4 A G 4: 116,035,773 M283T probably benign Het
Obscn A G 11: 59,000,062 S7215P unknown Het
Olfr1042 A C 2: 86,159,574 S265R possibly damaging Het
Olfr1160 T C 2: 88,005,987 I264V probably damaging Het
Olfr1383 G A 11: 49,524,206 S161N possibly damaging Het
Olfr340 G A 2: 36,453,095 R170K probably benign Het
Olfr53 T C 7: 140,652,311 S111P probably damaging Het
Olfr677 T A 7: 105,057,090 Y281* probably null Het
Olfr736 T C 14: 50,392,864 I36T probably benign Het
Per1 T C 11: 69,104,043 F563S probably benign Het
Pik3c3 T A 18: 30,303,078 probably benign Het
Pitrm1 A T 13: 6,555,639 K207N probably damaging Het
Prdm10 C T 9: 31,316,230 R44C probably damaging Het
Rab40c A T 17: 25,885,148 I90N probably damaging Het
Rbl1 A G 2: 157,199,414 probably null Het
Rnf17 G A 14: 56,514,106 G1467E probably damaging Het
Rpgrip1 A G 14: 52,149,384 probably benign Het
Sall1 A T 8: 89,030,268 N1069K probably benign Het
Scap T C 9: 110,372,222 I93T possibly damaging Het
Sez6 T C 11: 77,974,344 probably benign Het
Slc22a30 A T 19: 8,370,197 S280T probably benign Het
Slc26a5 A C 5: 21,811,344 probably null Het
St18 T C 1: 6,848,948 V901A probably benign Het
Syne2 T C 12: 75,963,876 L2519P probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tmem51 T C 4: 142,031,925 T171A probably benign Het
Tns4 A T 11: 99,075,198 I453N probably damaging Het
Trank1 A T 9: 111,392,910 H2905L probably benign Het
Trim13 C T 14: 61,604,717 T61I possibly damaging Het
Trim75 T C 8: 64,982,928 Q290R possibly damaging Het
Ttn C A 2: 76,729,200 R29619L probably damaging Het
Ugt2b38 T A 5: 87,420,558 M293L probably benign Het
Vmn1r22 T A 6: 57,900,528 N155Y probably benign Het
Vmn2r18 T C 5: 151,584,804 Y285C probably benign Het
Vmn2r84 C T 10: 130,386,719 probably benign Het
Vwde A C 6: 13,220,005 L49R probably damaging Het
Yipf2 T A 9: 21,591,966 E68D possibly damaging Het
Zfand5 C A 19: 21,279,758 probably benign Het
Other mutations in Fry
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Fry APN 5 150340404 nonsense probably null
IGL00328:Fry APN 5 150340404 nonsense probably null
IGL00841:Fry APN 5 150422724 missense probably benign
IGL00938:Fry APN 5 150370180 missense probably damaging 1.00
IGL01015:Fry APN 5 150422787 missense probably benign 0.18
IGL01401:Fry APN 5 150438788 missense probably benign
IGL01616:Fry APN 5 150399599 missense probably damaging 1.00
IGL01616:Fry APN 5 150438811 splice site probably null
IGL01748:Fry APN 5 150345651 splice site probably benign
IGL01965:Fry APN 5 150381621 missense probably damaging 1.00
IGL02030:Fry APN 5 150471618 splice site probably benign
IGL02079:Fry APN 5 150399624 missense probably damaging 0.97
IGL02087:Fry APN 5 150403594 missense probably benign 0.23
IGL02113:Fry APN 5 150399605 missense probably benign
IGL02209:Fry APN 5 150437026 missense probably benign 0.00
IGL02250:Fry APN 5 150403434 splice site probably benign
IGL02265:Fry APN 5 150437153 missense probably damaging 1.00
IGL02486:Fry APN 5 150491177 missense probably damaging 0.99
IGL02552:Fry APN 5 150380910 missense probably damaging 1.00
IGL02881:Fry APN 5 150359051 missense probably damaging 0.99
IGL03008:Fry APN 5 150345556 missense possibly damaging 0.82
IGL03140:Fry APN 5 150495701 missense probably damaging 0.98
IGL03171:Fry APN 5 150380809 missense probably damaging 1.00
IGL03389:Fry APN 5 150394231 missense probably damaging 1.00
IGL03404:Fry APN 5 150326168 missense probably damaging 1.00
R0023:Fry UTSW 5 150451098 missense possibly damaging 0.78
R0024:Fry UTSW 5 150380803 missense probably benign 0.03
R0030:Fry UTSW 5 150372569 nonsense probably null
R0053:Fry UTSW 5 150461377 splice site probably benign
R0212:Fry UTSW 5 150496397 missense probably damaging 0.99
R0241:Fry UTSW 5 150260346 intron probably benign
R0265:Fry UTSW 5 150434776 missense probably damaging 1.00
R0317:Fry UTSW 5 150471468 missense probably damaging 1.00
R0532:Fry UTSW 5 150433707 unclassified probably benign
R0532:Fry UTSW 5 150478761 splice site probably benign
R0599:Fry UTSW 5 150437159 missense probably damaging 0.99
R0631:Fry UTSW 5 150496352 missense possibly damaging 0.82
R0723:Fry UTSW 5 150496360 missense probably damaging 1.00
R0766:Fry UTSW 5 150403432 splice site probably benign
R0790:Fry UTSW 5 150466437 missense probably benign 0.06
R0928:Fry UTSW 5 150437084 missense probably damaging 1.00
R1104:Fry UTSW 5 150496289 missense probably damaging 1.00
R1144:Fry UTSW 5 150418464 missense possibly damaging 0.94
R1172:Fry UTSW 5 150481494 nonsense probably null
R1312:Fry UTSW 5 150403432 splice site probably benign
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1437:Fry UTSW 5 150310425 missense possibly damaging 0.92
R1458:Fry UTSW 5 150380859 missense probably damaging 1.00
R1542:Fry UTSW 5 150404966 missense probably benign 0.13
R1692:Fry UTSW 5 150370227 missense probably damaging 1.00
R1826:Fry UTSW 5 150436709 missense possibly damaging 0.82
R1874:Fry UTSW 5 150345921 missense probably damaging 1.00
R1875:Fry UTSW 5 150326132 missense probably damaging 1.00
R1881:Fry UTSW 5 150478046 missense probably damaging 0.97
R1884:Fry UTSW 5 150403520 missense probably benign 0.00
R1929:Fry UTSW 5 150400924 missense probably null 0.02
R2066:Fry UTSW 5 150370119 splice site probably benign
R2270:Fry UTSW 5 150400924 missense probably null 0.02
R2356:Fry UTSW 5 150471432 missense probably benign
R3720:Fry UTSW 5 150454572 missense probably damaging 1.00
R3773:Fry UTSW 5 150398198 missense probably damaging 0.96
R3824:Fry UTSW 5 150496419 missense possibly damaging 0.94
R3902:Fry UTSW 5 150345927 missense probably damaging 1.00
R3923:Fry UTSW 5 150413349 missense probably benign
R4250:Fry UTSW 5 150310360 missense probably damaging 0.99
R4332:Fry UTSW 5 150381663 missense probably damaging 1.00
R4495:Fry UTSW 5 150310463 missense probably damaging 1.00
R4610:Fry UTSW 5 150386104 missense probably damaging 1.00
R4682:Fry UTSW 5 150422754 missense probably damaging 1.00
R4732:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4733:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4755:Fry UTSW 5 150398254 missense probably damaging 0.99
R4788:Fry UTSW 5 150399636 missense probably benign 0.00
R4803:Fry UTSW 5 150399533 missense probably benign 0.31
R4858:Fry UTSW 5 150401643 missense possibly damaging 0.78
R4872:Fry UTSW 5 150394239 critical splice donor site probably null
R4902:Fry UTSW 5 150495703 missense probably benign 0.43
R4915:Fry UTSW 5 150478863 missense probably benign 0.30
R4938:Fry UTSW 5 150477989 missense probably damaging 1.00
R4983:Fry UTSW 5 150398254 missense probably damaging 1.00
R5004:Fry UTSW 5 150433604 missense probably benign 0.16
R5040:Fry UTSW 5 150388854 missense probably damaging 0.99
R5145:Fry UTSW 5 150370224 missense probably damaging 0.98
R5170:Fry UTSW 5 150429854 missense probably benign 0.03
R5233:Fry UTSW 5 150469720 missense possibly damaging 0.71
R5428:Fry UTSW 5 150405359 missense possibly damaging 0.89
R5468:Fry UTSW 5 150399588 missense probably benign 0.44
R5481:Fry UTSW 5 150260319 missense probably benign 0.01
R5494:Fry UTSW 5 150390667 missense probably damaging 1.00
R5538:Fry UTSW 5 150495848 missense probably damaging 1.00
R5638:Fry UTSW 5 150359081 missense possibly damaging 0.46
R5645:Fry UTSW 5 150380867 missense probably damaging 1.00
R5716:Fry UTSW 5 150370221 nonsense probably null
R5812:Fry UTSW 5 150399671 missense probably damaging 0.99
R5813:Fry UTSW 5 150399671 missense probably damaging 0.99
R5873:Fry UTSW 5 150378885 missense probably damaging 1.00
R5933:Fry UTSW 5 150390800 intron probably benign
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6158:Fry UTSW 5 150454572 missense probably damaging 1.00
R6178:Fry UTSW 5 150454522 missense probably damaging 1.00
R6481:Fry UTSW 5 150386014 missense probably damaging 1.00
R6562:Fry UTSW 5 150326149 missense probably damaging 1.00
R6676:Fry UTSW 5 150380922 missense probably benign 0.22
R6717:Fry UTSW 5 150496312 missense probably benign 0.00
R6828:Fry UTSW 5 150466446 splice site probably null
R6874:Fry UTSW 5 150437303 missense probably benign 0.00
R6930:Fry UTSW 5 150428230 missense probably benign 0.00
R6963:Fry UTSW 5 150457844 missense probably benign 0.17
R6965:Fry UTSW 5 150416220 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ATGCAACAGCCAGTGTCTCAGG -3'
(R):5'- CTTCCAGGAATGTCAGAGAGCACAG -3'

Sequencing Primer
(F):5'- CAGTGTCTCAGGGACTGAC -3'
(R):5'- agagagaaagagagggggag -3'
Posted On2013-04-11