Incidental Mutation 'R1743:Zc3h14'
ID200532
Institutional Source Beutler Lab
Gene Symbol Zc3h14
Ensembl Gene ENSMUSG00000021012
Gene Namezinc finger CCCH type containing 14
Synonyms1700016A15Rik, 1010001P15Rik, 2700069A02Rik
MMRRC Submission 039775-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1743 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location98746964-98787753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98779189 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 479 (V479A)
Ref Sequence ENSEMBL: ENSMUSP00000105732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021399] [ENSMUST00000057000] [ENSMUST00000110104] [ENSMUST00000110105] [ENSMUST00000221532]
Predicted Effect probably benign
Transcript: ENSMUST00000021399
SMART Domains Protein: ENSMUSP00000021399
Gene: ENSMUSG00000021012

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
coiled coil region 69 91 N/A INTRINSIC
ZnF_C3H1 170 193 7.16e-1 SMART
ZnF_C3H1 195 214 5.27e1 SMART
ZnF_C3H1 250 272 5.55e0 SMART
Pfam:zf-CCCH_2 273 290 1.3e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057000
SMART Domains Protein: ENSMUSP00000055879
Gene: ENSMUSG00000021012

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 440 463 7.16e-1 SMART
ZnF_C3H1 465 484 5.27e1 SMART
ZnF_C3H1 520 542 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110104
SMART Domains Protein: ENSMUSP00000105731
Gene: ENSMUSG00000021012

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 465 488 7.16e-1 SMART
ZnF_C3H1 490 509 5.27e1 SMART
ZnF_C3H1 545 567 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110105
AA Change: V479A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000105732
Gene: ENSMUSG00000021012
AA Change: V479A

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 596 619 7.16e-1 SMART
ZnF_C3H1 621 640 5.27e1 SMART
ZnF_C3H1 676 698 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222461
Predicted Effect unknown
Transcript: ENSMUST00000223451
AA Change: V150A
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a poly(A)-binding protein that can affect gene expression and poly(A) tail length. The encoded protein may influence mRNA stability, nuclear export, and translation. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous knockout results in impaired spatial working memory, enlarged anterior lateral ventricles in the brain, small testes and reduced litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff4 T A 11: 53,368,695 M11K possibly damaging Het
Ank2 T C 3: 126,928,675 D88G probably damaging Het
Arhgap32 A G 9: 32,259,431 E1169G probably benign Het
Atp7b A T 8: 22,006,387 V865E probably damaging Het
Bcl2l13 T A 6: 120,848,543 Y13* probably null Het
Birc6 A G 17: 74,579,756 Q693R possibly damaging Het
Bub1 T C 2: 127,813,850 D520G probably damaging Het
Ccdc15 A T 9: 37,277,477 Y770* probably null Het
Cenpf T C 1: 189,654,263 E1940G probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cmya5 A G 13: 93,097,317 V421A probably benign Het
Cnnm1 A T 19: 43,471,913 Y698F possibly damaging Het
Cnst C T 1: 179,610,392 T507I probably benign Het
Coq8a T C 1: 180,182,229 M4V probably benign Het
Csmd3 A G 15: 48,622,089 L140P probably damaging Het
Cul2 A T 18: 3,426,851 I431F probably damaging Het
Dnah8 G T 17: 30,769,651 E3198D probably benign Het
Epn2 T A 11: 61,546,411 I112F possibly damaging Het
Ext2 T C 2: 93,730,225 E532G probably damaging Het
Fndc3a A T 14: 72,652,081 V37E probably damaging Het
Gabbr2 A G 4: 46,677,603 F759S possibly damaging Het
Ghr G A 15: 3,320,241 P485L probably benign Het
Glipr1l2 G T 10: 112,092,565 V122L probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm13128 T C 4: 144,333,005 S429P probably benign Het
Gm6871 G T 7: 41,546,452 T287K probably damaging Het
Gm7275 A G 16: 48,073,757 noncoding transcript Het
Hephl1 C T 9: 15,090,068 V254I probably damaging Het
Hnf4a C A 2: 163,566,339 Q362K possibly damaging Het
Kcne3 C T 7: 100,184,424 R83C probably damaging Het
Klb C A 5: 65,375,861 N504K probably damaging Het
Loxl2 T A 14: 69,692,402 I743N possibly damaging Het
Lrrc9 A T 12: 72,456,117 L287F probably damaging Het
Mcm3ap C T 10: 76,484,674 P822L possibly damaging Het
Nacc2 T C 2: 26,060,143 N527S probably benign Het
Ncam1 G T 9: 49,557,145 P338H probably damaging Het
Nfkbiz G T 16: 55,816,394 Q515K possibly damaging Het
Nipsnap2 T C 5: 129,757,085 L263P probably damaging Het
Nlrp1a A T 11: 71,124,206 S73T probably benign Het
Nomo1 G A 7: 46,070,037 probably null Het
Nos3 G A 5: 24,377,312 G594D probably benign Het
Olfr1330 A G 4: 118,893,526 T148A probably benign Het
Olfr1359 A G 13: 21,703,450 I150V probably benign Het
Olfr148 A T 9: 39,613,620 T18S possibly damaging Het
Oprm1 A G 10: 6,830,105 I256V probably damaging Het
Oxct2a A T 4: 123,323,516 L24Q possibly damaging Het
Pcdhb14 T G 18: 37,448,178 S112R probably benign Het
Polr2a A G 11: 69,739,503 I1246T probably damaging Het
Ppil4 A T 10: 7,807,381 K327N probably damaging Het
Pstpip1 T C 9: 56,125,930 Y249H probably damaging Het
Qrsl1 A T 10: 43,881,515 V369E probably damaging Het
Ranbp10 G T 8: 105,779,978 P237T probably damaging Het
Rapgef6 A G 11: 54,676,284 N1097S probably damaging Het
Repin1 T A 6: 48,597,750 S538T probably damaging Het
Rims2 A T 15: 39,679,650 M1151L probably benign Het
Rin3 T A 12: 102,390,096 D965E possibly damaging Het
Sdc2 A G 15: 33,028,078 D114G probably benign Het
Slc25a30 C A 14: 75,775,083 A42S probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssh2 T A 11: 77,437,756 F383I probably damaging Het
St8sia1 A T 6: 142,829,016 V279E probably damaging Het
Tacc2 C A 7: 130,626,598 S1690* probably null Het
Taf1b A G 12: 24,547,178 D372G possibly damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem165 G T 5: 76,207,826 G272C probably damaging Het
Tsc22d2 TCAGTTAACACCTATGAACAGT TCAGT 3: 58,417,539 probably null Het
Tssk4 C A 14: 55,651,031 A119D probably damaging Het
Usp9y A G Y: 1,316,727 Y1941H probably damaging Het
Vmn2r42 A T 7: 8,184,265 M786K probably benign Het
Wdfy3 G T 5: 101,844,065 T3470K probably benign Het
Wdr63 C A 3: 146,097,262 R58L possibly damaging Het
Zfp821 G A 8: 109,724,164 R263Q probably damaging Het
Other mutations in Zc3h14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Zc3h14 APN 12 98747524 critical splice donor site probably null
IGL00946:Zc3h14 APN 12 98759883 splice site probably benign
IGL00969:Zc3h14 APN 12 98758843 missense probably benign 0.00
IGL01626:Zc3h14 APN 12 98779186 missense possibly damaging 0.72
IGL01891:Zc3h14 APN 12 98758947 unclassified probably benign
IGL02119:Zc3h14 APN 12 98763895 missense probably benign 0.00
IGL02484:Zc3h14 APN 12 98774301 missense probably benign 0.14
IGL02744:Zc3h14 APN 12 98784975 missense possibly damaging 0.67
IGL02894:Zc3h14 APN 12 98758943 critical splice donor site probably null
R0408:Zc3h14 UTSW 12 98763823 missense probably damaging 1.00
R0739:Zc3h14 UTSW 12 98757201 missense probably damaging 0.99
R0865:Zc3h14 UTSW 12 98779269 critical splice donor site probably null
R0926:Zc3h14 UTSW 12 98758590 missense possibly damaging 0.94
R1530:Zc3h14 UTSW 12 98785003 missense probably damaging 1.00
R1735:Zc3h14 UTSW 12 98758580 missense probably damaging 1.00
R1848:Zc3h14 UTSW 12 98752832 missense possibly damaging 0.89
R1851:Zc3h14 UTSW 12 98760354 nonsense probably null
R1978:Zc3h14 UTSW 12 98763922 missense probably damaging 0.97
R2011:Zc3h14 UTSW 12 98780268 missense possibly damaging 0.76
R2198:Zc3h14 UTSW 12 98752809 missense probably damaging 1.00
R2198:Zc3h14 UTSW 12 98752810 missense possibly damaging 0.94
R2263:Zc3h14 UTSW 12 98758514 missense probably benign 0.32
R3762:Zc3h14 UTSW 12 98758643 missense probably damaging 1.00
R4210:Zc3h14 UTSW 12 98785399 missense probably damaging 1.00
R4353:Zc3h14 UTSW 12 98763960 missense possibly damaging 0.70
R4360:Zc3h14 UTSW 12 98780197 missense probably benign 0.09
R4814:Zc3h14 UTSW 12 98752848 missense probably damaging 1.00
R4815:Zc3h14 UTSW 12 98752848 missense probably damaging 1.00
R4817:Zc3h14 UTSW 12 98752848 missense probably damaging 1.00
R4947:Zc3h14 UTSW 12 98759824 missense probably benign
R5077:Zc3h14 UTSW 12 98757206 critical splice donor site probably null
R5431:Zc3h14 UTSW 12 98780065 missense possibly damaging 0.94
R5783:Zc3h14 UTSW 12 98757175 missense probably damaging 0.99
R5850:Zc3h14 UTSW 12 98779155 missense probably damaging 0.97
R6034:Zc3h14 UTSW 12 98771373 missense probably benign 0.01
R6034:Zc3h14 UTSW 12 98771373 missense probably benign 0.01
R6291:Zc3h14 UTSW 12 98759828 missense probably damaging 1.00
R6338:Zc3h14 UTSW 12 98758590 missense possibly damaging 0.94
R6595:Zc3h14 UTSW 12 98757026 missense probably damaging 0.98
R6737:Zc3h14 UTSW 12 98785046 missense probably damaging 1.00
R6932:Zc3h14 UTSW 12 98771077 intron probably benign
R7074:Zc3h14 UTSW 12 98758600 missense possibly damaging 0.96
R7204:Zc3h14 UTSW 12 98771356 missense probably damaging 1.00
R7237:Zc3h14 UTSW 12 98780149 missense probably benign 0.34
R7267:Zc3h14 UTSW 12 98785729 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCCTTCTCTGCCTTAGGCAAAG -3'
(R):5'- ACCATCTAGTGGGAGCTACAGGAAC -3'

Sequencing Primer
(F):5'- GAGGAAAGGACTATTTGAATTCTCTG -3'
(R):5'- CAGGGAAGCTGGGAACTAAC -3'
Posted On2014-05-23