Incidental Mutation 'R1743:Dnah8'
Institutional Source Beutler Lab
Gene Symbol Dnah8
Ensembl Gene ENSMUSG00000033826
Gene Namedynein, axonemal, heavy chain 8
SynonymsDnahc8, P1-Loop, Hst6.7b
MMRRC Submission 039775-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.516) question?
Stock #R1743 (G1)
Quality Score225
Status Not validated
Chromosomal Location30624354-30875264 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 30769651 bp
Amino Acid Change Glutamic Acid to Aspartic acid at position 3198 (E3198D)
Ref Sequence ENSEMBL: ENSMUSP00000127878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170651]
Predicted Effect probably benign
Transcript: ENSMUST00000170651
AA Change: E3198D

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127878
Gene: ENSMUSG00000033826
AA Change: E3198D

low complexity region 2 54 N/A INTRINSIC
Pfam:DHC_N1 379 936 8.4e-159 PFAM
low complexity region 1069 1080 N/A INTRINSIC
low complexity region 1224 1237 N/A INTRINSIC
Pfam:DHC_N2 1509 1917 1.6e-134 PFAM
AAA 2082 2226 1.38e-1 SMART
AAA 2363 2516 2.04e-1 SMART
AAA 2689 2837 8.15e-2 SMART
Pfam:AAA_8 3022 3294 4e-72 PFAM
Pfam:MT 3306 3656 3.6e-48 PFAM
Pfam:AAA_9 3676 3901 6.7e-85 PFAM
Pfam:Dynein_heavy 4039 4728 8.4e-250 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a heavy chain of an axonemal dynein involved in sperm and respiratory cilia motility. Axonemal dyneins generate force through hydrolysis of ATP and binding to microtubules. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff4 T A 11: 53,368,695 M11K possibly damaging Het
Ank2 T C 3: 126,928,675 D88G probably damaging Het
Arhgap32 A G 9: 32,259,431 E1169G probably benign Het
Atp7b A T 8: 22,006,387 V865E probably damaging Het
Bcl2l13 T A 6: 120,848,543 Y13* probably null Het
Birc6 A G 17: 74,579,756 Q693R possibly damaging Het
Bub1 T C 2: 127,813,850 D520G probably damaging Het
Ccdc15 A T 9: 37,277,477 Y770* probably null Het
Cenpf T C 1: 189,654,263 E1940G probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cmya5 A G 13: 93,097,317 V421A probably benign Het
Cnnm1 A T 19: 43,471,913 Y698F possibly damaging Het
Cnst C T 1: 179,610,392 T507I probably benign Het
Coq8a T C 1: 180,182,229 M4V probably benign Het
Csmd3 A G 15: 48,622,089 L140P probably damaging Het
Cul2 A T 18: 3,426,851 I431F probably damaging Het
Epn2 T A 11: 61,546,411 I112F possibly damaging Het
Ext2 T C 2: 93,730,225 E532G probably damaging Het
Fndc3a A T 14: 72,652,081 V37E probably damaging Het
Gabbr2 A G 4: 46,677,603 F759S possibly damaging Het
Ghr G A 15: 3,320,241 P485L probably benign Het
Glipr1l2 G T 10: 112,092,565 V122L probably benign Het
Gm13128 T C 4: 144,333,005 S429P probably benign Het
Gm6871 G T 7: 41,546,452 T287K probably damaging Het
Gm7275 A G 16: 48,073,757 noncoding transcript Het
Hephl1 C T 9: 15,090,068 V254I probably damaging Het
Hnf4a C A 2: 163,566,339 Q362K possibly damaging Het
Kcne3 C T 7: 100,184,424 R83C probably damaging Het
Klb C A 5: 65,375,861 N504K probably damaging Het
Loxl2 T A 14: 69,692,402 I743N possibly damaging Het
Lrrc9 A T 12: 72,456,117 L287F probably damaging Het
Mcm3ap C T 10: 76,484,674 P822L possibly damaging Het
Nacc2 T C 2: 26,060,143 N527S probably benign Het
Ncam1 G T 9: 49,557,145 P338H probably damaging Het
Nfkbiz G T 16: 55,816,394 Q515K possibly damaging Het
Nipsnap2 T C 5: 129,757,085 L263P probably damaging Het
Nlrp1a A T 11: 71,124,206 S73T probably benign Het
Nomo1 G A 7: 46,070,037 probably null Het
Nos3 G A 5: 24,377,312 G594D probably benign Het
Olfr1330 A G 4: 118,893,526 T148A probably benign Het
Olfr1359 A G 13: 21,703,450 I150V probably benign Het
Olfr148 A T 9: 39,613,620 T18S possibly damaging Het
Oprm1 A G 10: 6,830,105 I256V probably damaging Het
Oxct2a A T 4: 123,323,516 L24Q possibly damaging Het
Pcdhb14 T G 18: 37,448,178 S112R probably benign Het
Polr2a A G 11: 69,739,503 I1246T probably damaging Het
Ppil4 A T 10: 7,807,381 K327N probably damaging Het
Pstpip1 T C 9: 56,125,930 Y249H probably damaging Het
Qrsl1 A T 10: 43,881,515 V369E probably damaging Het
Ranbp10 G T 8: 105,779,978 P237T probably damaging Het
Rapgef6 A G 11: 54,676,284 N1097S probably damaging Het
Repin1 T A 6: 48,597,750 S538T probably damaging Het
Rims2 A T 15: 39,679,650 M1151L probably benign Het
Rin3 T A 12: 102,390,096 D965E possibly damaging Het
Sdc2 A G 15: 33,028,078 D114G probably benign Het
Slc25a30 C A 14: 75,775,083 A42S probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssh2 T A 11: 77,437,756 F383I probably damaging Het
St8sia1 A T 6: 142,829,016 V279E probably damaging Het
Tacc2 C A 7: 130,626,598 S1690* probably null Het
Taf1b A G 12: 24,547,178 D372G possibly damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem165 G T 5: 76,207,826 G272C probably damaging Het
Tsc22d2 TCAGTTAACACCTATGAACAGT TCAGT 3: 58,417,539 probably null Het
Tssk4 C A 14: 55,651,031 A119D probably damaging Het
Usp9y A G Y: 1,316,727 Y1941H probably damaging Het
Vmn2r42 A T 7: 8,184,265 M786K probably benign Het
Wdfy3 G T 5: 101,844,065 T3470K probably benign Het
Wdr63 C A 3: 146,097,262 R58L possibly damaging Het
Zc3h14 T C 12: 98,779,189 V479A probably benign Het
Zfp821 G A 8: 109,724,164 R263Q probably damaging Het
Other mutations in Dnah8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Dnah8 APN 17 30677176 missense probably benign 0.06
IGL00508:Dnah8 APN 17 30855930 missense probably damaging 1.00
IGL00547:Dnah8 APN 17 30815703 nonsense probably null
IGL00551:Dnah8 APN 17 30663478 nonsense probably null
IGL00732:Dnah8 APN 17 30656641 missense probably damaging 1.00
IGL00775:Dnah8 APN 17 30767906 nonsense probably null
IGL00840:Dnah8 APN 17 30790941 missense probably damaging 1.00
IGL00845:Dnah8 APN 17 30819276 critical splice donor site probably null
IGL00953:Dnah8 APN 17 30706457 nonsense probably null
IGL00976:Dnah8 APN 17 30851710 missense probably damaging 0.98
IGL01395:Dnah8 APN 17 30636005 missense probably benign 0.06
IGL01467:Dnah8 APN 17 30779916 missense probably damaging 1.00
IGL01469:Dnah8 APN 17 30683714 splice site probably benign
IGL01515:Dnah8 APN 17 30648485 missense probably benign
IGL01723:Dnah8 APN 17 30708471 missense probably damaging 1.00
IGL01837:Dnah8 APN 17 30751591 critical splice donor site probably null
IGL01921:Dnah8 APN 17 30736141 missense probably benign
IGL01958:Dnah8 APN 17 30855895 splice site probably benign
IGL01968:Dnah8 APN 17 30656598 nonsense probably null
IGL02093:Dnah8 APN 17 30717880 missense probably damaging 0.99
IGL02151:Dnah8 APN 17 30648417 missense possibly damaging 0.50
IGL02182:Dnah8 APN 17 30794763 missense possibly damaging 0.45
IGL02233:Dnah8 APN 17 30706513 critical splice donor site probably null
IGL02236:Dnah8 APN 17 30649773 nonsense probably null
IGL02259:Dnah8 APN 17 30759614 missense probably benign
IGL02263:Dnah8 APN 17 30729165 missense probably benign 0.00
IGL02303:Dnah8 APN 17 30713047 missense probably benign 0.03
IGL02341:Dnah8 APN 17 30747257 missense probably damaging 1.00
IGL02351:Dnah8 APN 17 30767811 missense probably damaging 1.00
IGL02358:Dnah8 APN 17 30767811 missense probably damaging 1.00
IGL02377:Dnah8 APN 17 30794796 missense probably damaging 0.98
IGL02390:Dnah8 APN 17 30830845 missense probably benign 0.01
IGL02392:Dnah8 APN 17 30818051 splice site probably benign
IGL02414:Dnah8 APN 17 30700413 missense probably benign
IGL02455:Dnah8 APN 17 30672334 missense probably damaging 0.99
IGL02817:Dnah8 APN 17 30668295 missense probably benign
IGL02831:Dnah8 APN 17 30712276 missense probably benign 0.23
IGL02863:Dnah8 APN 17 30769697 missense probably damaging 1.00
IGL02894:Dnah8 APN 17 30721110 nonsense probably null
IGL02954:Dnah8 APN 17 30704835 missense probably benign 0.30
IGL02964:Dnah8 APN 17 30746761 missense probably damaging 1.00
IGL03080:Dnah8 APN 17 30719006 missense probably benign 0.01
IGL03081:Dnah8 APN 17 30686373 splice site probably benign
IGL03086:Dnah8 APN 17 30742780 missense probably damaging 1.00
IGL03087:Dnah8 APN 17 30784144 missense probably benign
IGL03176:Dnah8 APN 17 30694037 missense probably benign
IGL03191:Dnah8 APN 17 30726830 missense probably damaging 0.99
IGL03210:Dnah8 APN 17 30815665 missense probably damaging 0.96
IGL03252:Dnah8 APN 17 30673920 splice site probably null
IGL03255:Dnah8 APN 17 30741381 missense probably damaging 1.00
IGL03288:Dnah8 APN 17 30672349 missense probably benign
IGL03348:Dnah8 APN 17 30746986 missense probably damaging 0.99
dynos UTSW 17 30715509 missense possibly damaging 0.84
joule UTSW 17 30713098 critical splice donor site probably null
FR4340:Dnah8 UTSW 17 30635463 small deletion probably benign
FR4737:Dnah8 UTSW 17 30635465 small deletion probably benign
FR4737:Dnah8 UTSW 17 30635477 small deletion probably benign
I2288:Dnah8 UTSW 17 30663454 missense probably benign
P0029:Dnah8 UTSW 17 30765720 missense probably damaging 1.00
PIT4812001:Dnah8 UTSW 17 30708445 missense probably benign 0.04
R0016:Dnah8 UTSW 17 30663316 missense probably benign
R0035:Dnah8 UTSW 17 30683621 splice site probably benign
R0035:Dnah8 UTSW 17 30683621 splice site probably benign
R0062:Dnah8 UTSW 17 30765711 missense probably damaging 1.00
R0062:Dnah8 UTSW 17 30765711 missense probably damaging 1.00
R0087:Dnah8 UTSW 17 30755119 missense probably damaging 1.00
R0090:Dnah8 UTSW 17 30784090 missense probably benign 0.20
R0119:Dnah8 UTSW 17 30715509 missense possibly damaging 0.84
R0164:Dnah8 UTSW 17 30748665 missense probably benign
R0164:Dnah8 UTSW 17 30748665 missense probably benign
R0184:Dnah8 UTSW 17 30683683 missense probably benign 0.04
R0240:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0240:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30765679 missense probably damaging 0.98
R0265:Dnah8 UTSW 17 30690271 missense probably benign
R0268:Dnah8 UTSW 17 30769707 missense probably damaging 1.00
R0282:Dnah8 UTSW 17 30736156 missense probably damaging 1.00
R0299:Dnah8 UTSW 17 30715509 missense possibly damaging 0.84
R0334:Dnah8 UTSW 17 30871351 missense probably damaging 0.99
R0393:Dnah8 UTSW 17 30708390 missense probably benign 0.02
R0423:Dnah8 UTSW 17 30701981 missense probably benign
R0470:Dnah8 UTSW 17 30708540 splice site probably benign
R0477:Dnah8 UTSW 17 30755080 missense probably damaging 1.00
R0490:Dnah8 UTSW 17 30700419 missense probably benign
R0499:Dnah8 UTSW 17 30715509 missense possibly damaging 0.84
R0582:Dnah8 UTSW 17 30718961 missense probably benign 0.01
R0601:Dnah8 UTSW 17 30708358 missense probably benign 0.06
R0646:Dnah8 UTSW 17 30684173 missense probably damaging 0.97
R0665:Dnah8 UTSW 17 30736155 missense probably damaging 0.99
R0800:Dnah8 UTSW 17 30704662 missense probably benign
R0843:Dnah8 UTSW 17 30813095 missense probably damaging 1.00
R0940:Dnah8 UTSW 17 30803243 missense probably damaging 1.00
R0964:Dnah8 UTSW 17 30673920 splice site probably null
R1102:Dnah8 UTSW 17 30854764 intron probably null
R1137:Dnah8 UTSW 17 30855936 missense probably damaging 1.00
R1342:Dnah8 UTSW 17 30721000 missense probably damaging 0.99
R1375:Dnah8 UTSW 17 30737295 missense probably damaging 1.00
R1377:Dnah8 UTSW 17 30840622 nonsense probably null
R1464:Dnah8 UTSW 17 30695173 missense possibly damaging 0.81
R1464:Dnah8 UTSW 17 30695173 missense possibly damaging 0.81
R1470:Dnah8 UTSW 17 30747277 nonsense probably null
R1470:Dnah8 UTSW 17 30747277 nonsense probably null
R1497:Dnah8 UTSW 17 30752075 missense probably damaging 1.00
R1513:Dnah8 UTSW 17 30673888 missense probably benign
R1541:Dnah8 UTSW 17 30747247 missense probably damaging 1.00
R1563:Dnah8 UTSW 17 30635664 missense probably benign 0.07
R1634:Dnah8 UTSW 17 30713098 critical splice donor site probably null
R1670:Dnah8 UTSW 17 30725124 missense probably damaging 1.00
R1710:Dnah8 UTSW 17 30854940 missense probably damaging 1.00
R1761:Dnah8 UTSW 17 30779916 missense probably damaging 1.00
R1785:Dnah8 UTSW 17 30722937 missense probably damaging 0.98
R1804:Dnah8 UTSW 17 30708407 missense probably benign 0.00
R1808:Dnah8 UTSW 17 30684186 missense probably damaging 1.00
R1824:Dnah8 UTSW 17 30731180 missense possibly damaging 0.67
R1836:Dnah8 UTSW 17 30874927 missense possibly damaging 0.94
R1935:Dnah8 UTSW 17 30635505 missense unknown
R1935:Dnah8 UTSW 17 30726896 splice site probably benign
R1940:Dnah8 UTSW 17 30731207 missense probably damaging 1.00
R1946:Dnah8 UTSW 17 30712385 missense probably benign 0.00
R2025:Dnah8 UTSW 17 30731159 missense probably damaging 0.99
R2038:Dnah8 UTSW 17 30758281 missense probably damaging 1.00
R2042:Dnah8 UTSW 17 30635658 missense probably benign 0.01
R2148:Dnah8 UTSW 17 30737258 missense probably damaging 1.00
R2177:Dnah8 UTSW 17 30653393 missense probably benign
R2180:Dnah8 UTSW 17 30840647 missense probably benign 0.00
R2262:Dnah8 UTSW 17 30673835 missense probably damaging 1.00
R2263:Dnah8 UTSW 17 30673835 missense probably damaging 1.00
R2328:Dnah8 UTSW 17 30794744 missense probably damaging 1.00
R2357:Dnah8 UTSW 17 30771872 missense probably benign
R2357:Dnah8 UTSW 17 30874935 missense probably benign 0.00
R2360:Dnah8 UTSW 17 30677204 missense probably benign 0.22
R2496:Dnah8 UTSW 17 30851731 missense probably damaging 1.00
R2497:Dnah8 UTSW 17 30741365 nonsense probably null
R2509:Dnah8 UTSW 17 30775045 missense probably benign 0.02
R3114:Dnah8 UTSW 17 30833568 missense probably benign 0.04
R3708:Dnah8 UTSW 17 30739657 missense probably damaging 0.98
R3720:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3722:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3727:Dnah8 UTSW 17 30739648 nonsense probably null
R3747:Dnah8 UTSW 17 30784174 nonsense probably null
R3748:Dnah8 UTSW 17 30784174 nonsense probably null
R3749:Dnah8 UTSW 17 30784174 nonsense probably null
R3787:Dnah8 UTSW 17 30755041 missense probably damaging 1.00
R3790:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3804:Dnah8 UTSW 17 30670647 missense probably benign 0.00
R3857:Dnah8 UTSW 17 30663422 missense probably damaging 0.96
R3898:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3899:Dnah8 UTSW 17 30854898 missense probably damaging 1.00
R3938:Dnah8 UTSW 17 30854937 missense probably damaging 1.00
R3943:Dnah8 UTSW 17 30694065 splice site probably benign
R4091:Dnah8 UTSW 17 30769839 missense probably damaging 1.00
R4291:Dnah8 UTSW 17 30748559 missense probably benign
R4326:Dnah8 UTSW 17 30752092 missense probably benign 0.04
R4346:Dnah8 UTSW 17 30725098 missense possibly damaging 0.92
R4429:Dnah8 UTSW 17 30752146 missense probably damaging 1.00
R4457:Dnah8 UTSW 17 30813151 missense probably benign
R4475:Dnah8 UTSW 17 30656985 missense probably benign 0.12
R4565:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4566:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4568:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4573:Dnah8 UTSW 17 30700406 missense probably benign 0.00
R4580:Dnah8 UTSW 17 30662052 missense probably benign 0.00
R4585:Dnah8 UTSW 17 30751567 missense probably benign 0.01
R4611:Dnah8 UTSW 17 30684237 missense probably damaging 1.00
R4720:Dnah8 UTSW 17 30683634 missense probably benign 0.08
R4721:Dnah8 UTSW 17 30725166 missense probably damaging 1.00
R4727:Dnah8 UTSW 17 30851747 missense probably damaging 1.00
R4731:Dnah8 UTSW 17 30775061 missense probably null 0.02
R4732:Dnah8 UTSW 17 30775061 missense probably null 0.02
R4733:Dnah8 UTSW 17 30775061 missense probably null 0.02
R4798:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4814:Dnah8 UTSW 17 30767924 missense probably damaging 1.00
R4892:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4894:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4900:Dnah8 UTSW 17 30746975 missense probably damaging 1.00
R4901:Dnah8 UTSW 17 30840714 critical splice donor site probably null
R4913:Dnah8 UTSW 17 30819139 missense probably damaging 0.99
R4931:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4932:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4933:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R4942:Dnah8 UTSW 17 30729142 missense probably benign
R4969:Dnah8 UTSW 17 30723014 missense probably damaging 1.00
R4975:Dnah8 UTSW 17 30656985 missense probably benign 0.12
R4977:Dnah8 UTSW 17 30663301 missense probably benign 0.00
R5001:Dnah8 UTSW 17 30787185 missense probably damaging 1.00
R5011:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5013:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5014:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5024:Dnah8 UTSW 17 30736096 missense probably damaging 1.00
R5075:Dnah8 UTSW 17 30739757 critical splice donor site probably null
R5075:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5075:Dnah8 UTSW 17 30800531 missense probably damaging 1.00
R5112:Dnah8 UTSW 17 30731038 missense probably benign 0.02
R5121:Dnah8 UTSW 17 30810353 missense probably benign 0.14
R5138:Dnah8 UTSW 17 30765597 missense probably damaging 0.99
R5151:Dnah8 UTSW 17 30712295 missense probably benign 0.06
R5191:Dnah8 UTSW 17 30746765 missense probably damaging 1.00
R5238:Dnah8 UTSW 17 30790917 missense probably damaging 1.00
R5260:Dnah8 UTSW 17 30700419 missense probably benign
R5358:Dnah8 UTSW 17 30746954 missense probably damaging 1.00
R5403:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5404:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5482:Dnah8 UTSW 17 30800547 missense probably damaging 0.96
R5489:Dnah8 UTSW 17 30790956 missense probably damaging 1.00
R5513:Dnah8 UTSW 17 30752916 missense probably damaging 0.99
R5635:Dnah8 UTSW 17 30706386 missense probably benign 0.00
R5640:Dnah8 UTSW 17 30803108 missense probably damaging 1.00
R5649:Dnah8 UTSW 17 30800587 missense probably benign 0.13
R5662:Dnah8 UTSW 17 30737333 missense probably damaging 1.00
R5673:Dnah8 UTSW 17 30803261 missense probably damaging 1.00
R5677:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5699:Dnah8 UTSW 17 30810324 missense probably benign 0.22
R5737:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5738:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R5739:Dnah8 UTSW 17 30719007 missense probably benign 0.00
R5766:Dnah8 UTSW 17 30690261 missense probably benign 0.01
R5790:Dnah8 UTSW 17 30875004 missense probably damaging 0.98
R5848:Dnah8 UTSW 17 30728191 missense possibly damaging 0.69
R5854:Dnah8 UTSW 17 30794763 missense possibly damaging 0.45
R5885:Dnah8 UTSW 17 30794717 missense probably damaging 1.00
R5886:Dnah8 UTSW 17 30794717 missense probably damaging 1.00
R5887:Dnah8 UTSW 17 30794717 missense probably damaging 1.00
R5899:Dnah8 UTSW 17 30656685 missense probably benign 0.32
R5979:Dnah8 UTSW 17 30815664 nonsense probably null
R5986:Dnah8 UTSW 17 30851630 missense possibly damaging 0.83
R5999:Dnah8 UTSW 17 30663305 missense probably benign 0.32
R6042:Dnah8 UTSW 17 30747265 missense probably damaging 1.00
R6175:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6181:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6237:Dnah8 UTSW 17 30747854 nonsense probably null
R6239:Dnah8 UTSW 17 30810359 missense probably damaging 0.99
R6337:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6365:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6416:Dnah8 UTSW 17 30765635 missense probably benign
R6443:Dnah8 UTSW 17 30771885 missense probably benign 0.10
R6478:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6479:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6480:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6481:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6533:Dnah8 UTSW 17 30746990 missense probably damaging 1.00
R6606:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6608:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6610:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6675:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6723:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6724:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6754:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6755:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6759:Dnah8 UTSW 17 30663292 splice site probably null
R6765:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6766:Dnah8 UTSW 17 30748568 missense probably benign 0.00
R6778:Dnah8 UTSW 17 30635666 missense probably benign 0.00
R6781:Dnah8 UTSW 17 30765724 frame shift probably null
R6788:Dnah8 UTSW 17 30648465 missense probably benign 0.14
R6814:Dnah8 UTSW 17 30762679 missense probably damaging 1.00
R6825:Dnah8 UTSW 17 30741173 missense probably damaging 1.00
R6838:Dnah8 UTSW 17 30710551 missense probably damaging 1.00
R6872:Dnah8 UTSW 17 30762679 missense probably damaging 1.00
R6877:Dnah8 UTSW 17 30746959 missense probably damaging 1.00
R6944:Dnah8 UTSW 17 30794659 missense probably benign 0.09
R6982:Dnah8 UTSW 17 30767925 missense probably benign 0.03
R6984:Dnah8 UTSW 17 30739738 missense probably damaging 1.00
R6987:Dnah8 UTSW 17 30662091 missense possibly damaging 0.95
R6988:Dnah8 UTSW 17 30643275 missense probably damaging 1.00
R7099:Dnah8 UTSW 17 30704724 missense possibly damaging 0.93
R7106:Dnah8 UTSW 17 30741178 missense probably damaging 1.00
R7112:Dnah8 UTSW 17 30871392 missense possibly damaging 0.79
R7146:Dnah8 UTSW 17 30644617 missense probably benign 0.01
R7146:Dnah8 UTSW 17 30769644 missense possibly damaging 0.90
R7309:Dnah8 UTSW 17 30875014 missense probably damaging 1.00
X0001:Dnah8 UTSW 17 30748680 missense probably damaging 1.00
X0013:Dnah8 UTSW 17 30819186 missense possibly damaging 0.71
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-05-23