Incidental Mutation 'R1744:Clca3a1'
ID200568
Institutional Source Beutler Lab
Gene Symbol Clca3a1
Ensembl Gene ENSMUSG00000056025
Gene Namechloride channel accessory 3A1
SynonymsClca1
MMRRC Submission 039776-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1744 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location144729677-144760977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 144746835 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 629 (A629D)
Ref Sequence ENSEMBL: ENSMUSP00000054526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029932] [ENSMUST00000059091]
Predicted Effect probably benign
Transcript: ENSMUST00000029932
SMART Domains Protein: ENSMUSP00000029932
Gene: ENSMUSG00000056025

DomainStartEndE-ValueType
Pfam:CLCA_N 1 262 5.8e-144 PFAM
VWA 306 473 1.81e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000059091
AA Change: A629D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054526
Gene: ENSMUSG00000056025
AA Change: A629D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.44e-23 SMART
Blast:FN3 758 857 2e-44 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196146
Meta Mutation Damage Score 0.0256 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 A G 5: 81,794,420 E1247G probably damaging Het
Bcl2l15 T A 3: 103,838,540 L165Q probably damaging Het
Cd163 C A 6: 124,307,028 A53E possibly damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Csde1 T A 3: 103,050,315 S463R probably benign Het
Cth C G 3: 157,906,268 R304P probably damaging Het
D7Ertd443e A G 7: 134,349,413 V177A probably benign Het
Ddx56 G A 11: 6,266,396 R189W probably damaging Het
Dennd2a A T 6: 39,480,251 F752L probably benign Het
Gabrp A T 11: 33,572,462 V28E probably benign Het
Gpam T C 19: 55,074,591 E763G probably damaging Het
Hars G A 18: 36,770,832 R266C probably benign Het
Klf7 C A 1: 64,079,213 R75L possibly damaging Het
Kmt2d T C 15: 98,865,047 K281E probably damaging Het
Lbx1 T C 19: 45,234,213 K124E probably damaging Het
Lcp2 T C 11: 34,069,911 probably null Het
Mab21l2 T C 3: 86,546,904 E263G possibly damaging Het
Macf1 A T 4: 123,475,853 I140K probably damaging Het
Mcemp1 G A 8: 3,666,054 A20T probably damaging Het
Met T C 6: 17,540,646 V137A possibly damaging Het
Mgat5 T C 1: 127,479,469 F624S probably damaging Het
Nutm2 T C 13: 50,469,354 I29T probably benign Het
Ociad1 T C 5: 73,300,719 probably null Het
Ogfod2 G A 5: 124,114,156 probably null Het
Olfr816 A C 10: 129,911,393 V295G probably damaging Het
Olfr967 A C 9: 39,750,415 T10P probably benign Het
Otoa G A 7: 121,127,776 probably benign Het
Otud3 A C 4: 138,895,748 L394R probably damaging Het
Pde5a T C 3: 122,747,897 V12A probably damaging Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prr27 A G 5: 87,843,047 I173V possibly damaging Het
Psg29 T C 7: 17,210,353 C263R probably damaging Het
Ptprm T C 17: 66,689,366 Y1242C probably damaging Het
Retsat C T 6: 72,606,575 R84* probably null Het
Rif1 G A 2: 52,112,392 V1953I possibly damaging Het
Ros1 A T 10: 52,123,379 N1137K probably damaging Het
Scn1a T C 2: 66,322,276 H787R probably benign Het
Sec16a T C 2: 26,439,186 E939G probably damaging Het
Sh2d4a G A 8: 68,331,155 G247D possibly damaging Het
Siglec1 A G 2: 131,081,299 S509P probably damaging Het
Slc25a30 A G 14: 75,763,330 I278T probably damaging Het
Slc6a20a C T 9: 123,662,993 V104I probably benign Het
Sp110 G C 1: 85,594,372 T70S probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Stxbp1 A G 2: 32,806,719 probably null Het
Tmem132b T C 5: 125,778,844 probably null Het
Tmem2 C A 19: 21,832,137 Y960* probably null Het
Tnfsf13b G A 8: 10,031,661 probably null Het
Trappc6a A G 7: 19,514,229 E38G probably damaging Het
Trps1 T C 15: 50,661,213 D857G probably damaging Het
Tspear T A 10: 77,864,884 probably null Het
Vmn1r23 A T 6: 57,925,925 N289K possibly damaging Het
Zcchc8 G A 5: 123,700,373 Q701* probably null Het
Zfp618 A T 4: 63,086,634 probably benign Het
Other mutations in Clca3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Clca3a1 APN 3 144755251 missense probably damaging 0.96
IGL01331:Clca3a1 APN 3 144747512 missense probably damaging 1.00
IGL01895:Clca3a1 APN 3 144747572 nonsense probably null
IGL01940:Clca3a1 APN 3 144746976 missense probably benign 0.25
IGL02162:Clca3a1 APN 3 144754803 missense probably damaging 0.98
IGL02200:Clca3a1 APN 3 144751929 splice site probably benign
IGL03093:Clca3a1 APN 3 144747501 missense probably damaging 0.99
Lucha UTSW 3 144749689 missense probably damaging 1.00
R0256:Clca3a1 UTSW 3 144730879 missense probably damaging 0.98
R0513:Clca3a1 UTSW 3 144760562 critical splice donor site probably null
R0543:Clca3a1 UTSW 3 144748394 splice site probably benign
R1522:Clca3a1 UTSW 3 144755171 missense probably benign 0.01
R1873:Clca3a1 UTSW 3 144746829 missense probably damaging 0.99
R2238:Clca3a1 UTSW 3 144752005 missense possibly damaging 0.94
R2278:Clca3a1 UTSW 3 144758024 missense probably damaging 0.99
R2516:Clca3a1 UTSW 3 144737858 splice site probably null
R3737:Clca3a1 UTSW 3 144730721 missense probably benign 0.01
R3981:Clca3a1 UTSW 3 144755309 missense probably benign 0.00
R3982:Clca3a1 UTSW 3 144755309 missense probably benign 0.00
R3983:Clca3a1 UTSW 3 144755309 missense probably benign 0.00
R4038:Clca3a1 UTSW 3 144755233 missense probably benign 0.35
R4382:Clca3a1 UTSW 3 144760722 start codon destroyed probably benign 0.08
R4543:Clca3a1 UTSW 3 144746988 missense probably damaging 1.00
R4766:Clca3a1 UTSW 3 144749712 missense probably damaging 1.00
R4899:Clca3a1 UTSW 3 144737961 missense probably damaging 1.00
R5090:Clca3a1 UTSW 3 144737872 missense probably benign 0.01
R5091:Clca3a1 UTSW 3 144730722 missense probably benign 0.00
R5205:Clca3a1 UTSW 3 144746784 missense possibly damaging 0.68
R5248:Clca3a1 UTSW 3 144737136 missense possibly damaging 0.62
R5354:Clca3a1 UTSW 3 144737005 missense possibly damaging 0.77
R5871:Clca3a1 UTSW 3 144754881 missense probably damaging 1.00
R5907:Clca3a1 UTSW 3 144749642 intron probably benign
R5976:Clca3a1 UTSW 3 144746875 missense probably damaging 1.00
R6190:Clca3a1 UTSW 3 144758060 missense probably benign 0.40
R6193:Clca3a1 UTSW 3 144759232 missense possibly damaging 0.65
R6263:Clca3a1 UTSW 3 144749778 missense probably damaging 1.00
R6299:Clca3a1 UTSW 3 144758514 missense probably damaging 0.99
R6327:Clca3a1 UTSW 3 144730797 missense probably benign 0.02
R6497:Clca3a1 UTSW 3 144759259 missense possibly damaging 0.81
R6542:Clca3a1 UTSW 3 144759260 missense probably benign 0.01
R6547:Clca3a1 UTSW 3 144736947 missense probably damaging 1.00
R6759:Clca3a1 UTSW 3 144749689 missense probably damaging 1.00
R7032:Clca3a1 UTSW 3 144747568 missense probably benign 0.07
R7063:Clca3a1 UTSW 3 144755206 missense probably damaging 0.97
R7139:Clca3a1 UTSW 3 144755302 missense possibly damaging 0.58
Z1088:Clca3a1 UTSW 3 144746953 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATTAAACCCACACGTTTTCTCTCA -3'
(R):5'- AGTTGATTACAATGACAGTGACCACTCG -3'

Sequencing Primer
(F):5'- gaagaagaagaagaagaagaagagag -3'
(R):5'- TCGAGCAAGAAGTCCCACC -3'
Posted On2014-05-23