Incidental Mutation 'R1744:Tnfsf13b'
ID200591
Institutional Source Beutler Lab
Gene Symbol Tnfsf13b
Ensembl Gene ENSMUSG00000031497
Gene Nametumor necrosis factor (ligand) superfamily, member 13b
SynonymsD8Ertd387e, BAFF, BLyS, TALL-1, zTNF4
MMRRC Submission 039776-MU
Accession Numbers

Genbank: NM_033622

Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R1744 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location10006467-10039072 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 10031661 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033892] [ENSMUST00000207792] [ENSMUST00000208683]
Predicted Effect probably null
Transcript: ENSMUST00000033892
SMART Domains Protein: ENSMUSP00000033892
Gene: ENSMUSG00000031497

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
TNF 169 308 1.88e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000207792
Predicted Effect probably benign
Transcript: ENSMUST00000208683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208770
Meta Mutation Damage Score 0.6232 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for receptors TNFRSF13B/TACI, TNFRSF17/BCMA, and TNFRSF13C/BAFFR. This cytokine is expressed in B cell lineage cells, and acts as a potent B cell activator. It has been also shown to play an important role in the proliferation and differentiation of B cells. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice have reduced number of B cells and reduced levels of immunoglobulins. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 A G 5: 81,794,420 E1247G probably damaging Het
Bcl2l15 T A 3: 103,838,540 L165Q probably damaging Het
Cd163 C A 6: 124,307,028 A53E possibly damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Clca3a1 G T 3: 144,746,835 A629D probably damaging Het
Csde1 T A 3: 103,050,315 S463R probably benign Het
Cth C G 3: 157,906,268 R304P probably damaging Het
D7Ertd443e A G 7: 134,349,413 V177A probably benign Het
Ddx56 G A 11: 6,266,396 R189W probably damaging Het
Dennd2a A T 6: 39,480,251 F752L probably benign Het
Gabrp A T 11: 33,572,462 V28E probably benign Het
Gpam T C 19: 55,074,591 E763G probably damaging Het
Hars G A 18: 36,770,832 R266C probably benign Het
Klf7 C A 1: 64,079,213 R75L possibly damaging Het
Kmt2d T C 15: 98,865,047 K281E probably damaging Het
Lbx1 T C 19: 45,234,213 K124E probably damaging Het
Lcp2 T C 11: 34,069,911 probably null Het
Mab21l2 T C 3: 86,546,904 E263G possibly damaging Het
Macf1 A T 4: 123,475,853 I140K probably damaging Het
Mcemp1 G A 8: 3,666,054 A20T probably damaging Het
Met T C 6: 17,540,646 V137A possibly damaging Het
Mgat5 T C 1: 127,479,469 F624S probably damaging Het
Nutm2 T C 13: 50,469,354 I29T probably benign Het
Ociad1 T C 5: 73,300,719 probably null Het
Ogfod2 G A 5: 124,114,156 probably null Het
Olfr816 A C 10: 129,911,393 V295G probably damaging Het
Olfr967 A C 9: 39,750,415 T10P probably benign Het
Otoa G A 7: 121,127,776 probably benign Het
Otud3 A C 4: 138,895,748 L394R probably damaging Het
Pde5a T C 3: 122,747,897 V12A probably damaging Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prr27 A G 5: 87,843,047 I173V possibly damaging Het
Psg29 T C 7: 17,210,353 C263R probably damaging Het
Ptprm T C 17: 66,689,366 Y1242C probably damaging Het
Retsat C T 6: 72,606,575 R84* probably null Het
Rif1 G A 2: 52,112,392 V1953I possibly damaging Het
Ros1 A T 10: 52,123,379 N1137K probably damaging Het
Scn1a T C 2: 66,322,276 H787R probably benign Het
Sec16a T C 2: 26,439,186 E939G probably damaging Het
Sh2d4a G A 8: 68,331,155 G247D possibly damaging Het
Siglec1 A G 2: 131,081,299 S509P probably damaging Het
Slc25a30 A G 14: 75,763,330 I278T probably damaging Het
Slc6a20a C T 9: 123,662,993 V104I probably benign Het
Sp110 G C 1: 85,594,372 T70S probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Stxbp1 A G 2: 32,806,719 probably null Het
Tmem132b T C 5: 125,778,844 probably null Het
Tmem2 C A 19: 21,832,137 Y960* probably null Het
Trappc6a A G 7: 19,514,229 E38G probably damaging Het
Trps1 T C 15: 50,661,213 D857G probably damaging Het
Tspear T A 10: 77,864,884 probably null Het
Vmn1r23 A T 6: 57,925,925 N289K possibly damaging Het
Zcchc8 G A 5: 123,700,373 Q701* probably null Het
Zfp618 A T 4: 63,086,634 probably benign Het
Other mutations in Tnfsf13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Tnfsf13b APN 8 10031612 missense probably damaging 1.00
IGL01383:Tnfsf13b APN 8 10031528 missense probably damaging 0.98
IGL01650:Tnfsf13b APN 8 10031411 missense probably damaging 1.00
Applecrisp UTSW 8 10031534 missense probably damaging 1.00
arrested UTSW 8 10031545 missense possibly damaging 0.48
Frozen UTSW 8 10031661 splice site probably null
F5493:Tnfsf13b UTSW 8 10006916 missense probably damaging 1.00
R0610:Tnfsf13b UTSW 8 10031661 splice site probably null
R0723:Tnfsf13b UTSW 8 10007166 splice site probably null
R1435:Tnfsf13b UTSW 8 10035358 missense probably benign 0.06
R1648:Tnfsf13b UTSW 8 10031534 missense probably damaging 1.00
R2266:Tnfsf13b UTSW 8 10007306 missense probably benign 0.23
R3723:Tnfsf13b UTSW 8 10031545 missense possibly damaging 0.48
R5230:Tnfsf13b UTSW 8 10031608 missense possibly damaging 0.80
R5913:Tnfsf13b UTSW 8 10006988 missense probably damaging 1.00
R6741:Tnfsf13b UTSW 8 10007314 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CTATACACGGACCCCATCTTTGCTATG -3'
(R):5'- TGCTCCAATGTCAAATTCTGTGACCC -3'

Sequencing Primer
(F):5'- CTATGGGTCATGTCATCCAGAG -3'
(R):5'- actgcctctccatcccc -3'
Posted On2014-05-23