Incidental Mutation 'R0089:Sall1'
ID20066
Institutional Source Beutler Lab
Gene Symbol Sall1
Ensembl Gene ENSMUSG00000031665
Gene Namespalt like transcription factor 1
SynonymsMsal-3
MMRRC Submission 038376-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R0089 (G1)
Quality Score225
Status Validated (trace)
Chromosome8
Chromosomal Location89027235-89044162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89030268 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1069 (N1069K)
Ref Sequence ENSEMBL: ENSMUSP00000034090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034090]
Predicted Effect probably benign
Transcript: ENSMUST00000034090
AA Change: N1069K

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034090
Gene: ENSMUSG00000031665
AA Change: N1069K

DomainStartEndE-ValueType
low complexity region 133 152 N/A INTRINSIC
low complexity region 163 175 N/A INTRINSIC
low complexity region 229 257 N/A INTRINSIC
low complexity region 283 309 N/A INTRINSIC
low complexity region 361 396 N/A INTRINSIC
ZnF_C2H2 450 472 2.57e-3 SMART
ZnF_C2H2 478 500 3.21e-4 SMART
low complexity region 547 569 N/A INTRINSIC
ZnF_C2H2 705 727 3.02e0 SMART
ZnF_C2H2 733 755 8.6e-5 SMART
ZnF_C2H2 765 787 1.6e-4 SMART
low complexity region 842 861 N/A INTRINSIC
ZnF_C2H2 1000 1022 2.91e-2 SMART
ZnF_C2H2 1028 1050 4.94e-5 SMART
ZnF_C2H2 1133 1155 1.38e-3 SMART
ZnF_C2H2 1161 1183 1.22e-4 SMART
low complexity region 1257 1277 N/A INTRINSIC
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcriptional repressor and may be part of the NuRD histone deacetylase complex (HDAC). Defects in this gene are a cause of Townes-Brocks syndrome (TBS) as well as bronchio-oto-renal syndrome (BOR). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit kidney agenesis or dysgenesis and die perinatally. Homozygotes expressing only a truncated protein show renal agenesis, exencephaly, and limb defects; heterozygotes have hearing loss and cystic kidneys. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,292,886 V1583E possibly damaging Het
Ablim1 G T 19: 57,043,031 S654Y probably damaging Het
Acbd4 T C 11: 103,103,993 F59S probably damaging Het
Acot1 T C 12: 84,016,934 I272T probably damaging Het
Ankhd1 A G 18: 36,640,356 D1402G probably damaging Het
Birc6 T A 17: 74,638,376 F2800I possibly damaging Het
Brd1 T C 15: 88,701,198 E811G probably benign Het
Ccdc106 A G 7: 5,056,221 probably null Het
Ccdc81 G T 7: 89,893,116 A184E possibly damaging Het
Cenpt T C 8: 105,846,368 T364A probably benign Het
Crybg2 T C 4: 134,081,194 S1060P probably damaging Het
Dnttip2 A G 3: 122,275,462 T109A possibly damaging Het
Dpy19l2 A G 9: 24,695,793 L124P probably benign Het
Fat3 T C 9: 15,938,205 D3967G probably benign Het
Fbxo21 T A 5: 118,008,143 F610L probably benign Het
Fmo9 T C 1: 166,667,309 D341G probably benign Het
Frem3 A T 8: 80,615,878 H1600L possibly damaging Het
Fry A T 5: 150,340,427 K133N possibly damaging Het
Gm10647 A G 9: 66,798,330 probably benign Het
Gm13124 T A 4: 144,555,733 H163L probably benign Het
Gm16432 C T 1: 178,046,989 P141S unknown Het
Gm21319 A T 12: 87,773,513 I92N probably damaging Het
Gmps T C 3: 63,998,698 F472S probably benign Het
Grb10 T C 11: 11,934,192 probably benign Het
Grm6 G A 11: 50,859,965 G652S probably damaging Het
Heca G T 10: 17,908,100 D468E probably damaging Het
Heg1 C T 16: 33,763,615 S1033L probably damaging Het
Hepacam2 A G 6: 3,487,094 S12P probably damaging Het
Impdh1 G T 6: 29,206,326 H195N probably benign Het
Ipo7 T C 7: 110,050,765 probably benign Het
Itpr2 C T 6: 146,350,022 probably null Het
Kcnh6 G A 11: 106,009,022 C39Y probably benign Het
Kif26a T C 12: 112,177,403 S1364P probably damaging Het
Lins1 T A 7: 66,712,048 probably benign Het
Lrpap1 C T 5: 35,094,888 V328M possibly damaging Het
Lyn T G 4: 3,748,768 L249V probably benign Het
Mpp7 A G 18: 7,439,555 probably benign Het
Mtmr9 A G 14: 63,528,247 F400L possibly damaging Het
Mto1 G A 9: 78,473,872 S666N probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nsg1 T C 5: 38,155,630 E75G probably benign Het
Nsun4 A G 4: 116,035,773 M283T probably benign Het
Obscn A G 11: 59,000,062 S7215P unknown Het
Olfr1042 A C 2: 86,159,574 S265R possibly damaging Het
Olfr1160 T C 2: 88,005,987 I264V probably damaging Het
Olfr1383 G A 11: 49,524,206 S161N possibly damaging Het
Olfr340 G A 2: 36,453,095 R170K probably benign Het
Olfr53 T C 7: 140,652,311 S111P probably damaging Het
Olfr677 T A 7: 105,057,090 Y281* probably null Het
Olfr736 T C 14: 50,392,864 I36T probably benign Het
Per1 T C 11: 69,104,043 F563S probably benign Het
Pik3c3 T A 18: 30,303,078 probably benign Het
Pitrm1 A T 13: 6,555,639 K207N probably damaging Het
Prdm10 C T 9: 31,316,230 R44C probably damaging Het
Rab40c A T 17: 25,885,148 I90N probably damaging Het
Rbl1 A G 2: 157,199,414 probably null Het
Rnf17 G A 14: 56,514,106 G1467E probably damaging Het
Rpgrip1 A G 14: 52,149,384 probably benign Het
Scap T C 9: 110,372,222 I93T possibly damaging Het
Sez6 T C 11: 77,974,344 probably benign Het
Slc22a30 A T 19: 8,370,197 S280T probably benign Het
Slc26a5 A C 5: 21,811,344 probably null Het
St18 T C 1: 6,848,948 V901A probably benign Het
Syne2 T C 12: 75,963,876 L2519P probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tmem51 T C 4: 142,031,925 T171A probably benign Het
Tns4 A T 11: 99,075,198 I453N probably damaging Het
Trank1 A T 9: 111,392,910 H2905L probably benign Het
Trim13 C T 14: 61,604,717 T61I possibly damaging Het
Trim75 T C 8: 64,982,928 Q290R possibly damaging Het
Ttn C A 2: 76,729,200 R29619L probably damaging Het
Ugt2b38 T A 5: 87,420,558 M293L probably benign Het
Vmn1r22 T A 6: 57,900,528 N155Y probably benign Het
Vmn2r18 T C 5: 151,584,804 Y285C probably benign Het
Vmn2r84 C T 10: 130,386,719 probably benign Het
Vwde A C 6: 13,220,005 L49R probably damaging Het
Yipf2 T A 9: 21,591,966 E68D possibly damaging Het
Zfand5 C A 19: 21,279,758 probably benign Het
Other mutations in Sall1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Sall1 APN 8 89033344 missense probably damaging 1.00
IGL01670:Sall1 APN 8 89031571 missense probably benign 0.01
IGL01795:Sall1 APN 8 89028680 missense probably benign 0.02
IGL02041:Sall1 APN 8 89031469 missense probably damaging 1.00
IGL02078:Sall1 APN 8 89030375 missense probably damaging 0.99
IGL02105:Sall1 APN 8 89032568 missense probably damaging 0.99
IGL02354:Sall1 APN 8 89033049 missense probably benign 0.10
IGL02727:Sall1 APN 8 89030755 missense probably damaging 1.00
IGL02943:Sall1 APN 8 89031121 missense probably damaging 0.99
IGL03179:Sall1 APN 8 89031661 missense probably benign 0.00
R0386:Sall1 UTSW 8 89032604 missense probably damaging 1.00
R0532:Sall1 UTSW 8 89033191 missense probably benign
R0555:Sall1 UTSW 8 89031758 missense probably benign 0.16
R1203:Sall1 UTSW 8 89031934 missense probably damaging 1.00
R1406:Sall1 UTSW 8 89032444 missense probably benign 0.34
R1406:Sall1 UTSW 8 89032444 missense probably benign 0.34
R1449:Sall1 UTSW 8 89032483 missense probably benign
R1477:Sall1 UTSW 8 89032882 missense probably damaging 1.00
R1692:Sall1 UTSW 8 89028400 missense probably benign 0.00
R1839:Sall1 UTSW 8 89028716 missense possibly damaging 0.89
R2016:Sall1 UTSW 8 89028409 missense probably benign 0.10
R2041:Sall1 UTSW 8 89032801 missense probably benign
R3808:Sall1 UTSW 8 89031473 nonsense probably null
R3816:Sall1 UTSW 8 89032675 missense probably benign 0.00
R4085:Sall1 UTSW 8 89028509 missense probably benign
R4604:Sall1 UTSW 8 89030341 missense probably damaging 1.00
R4701:Sall1 UTSW 8 89031160 missense probably damaging 1.00
R5760:Sall1 UTSW 8 89028650 missense possibly damaging 0.94
R6091:Sall1 UTSW 8 89028619 missense probably damaging 1.00
R6213:Sall1 UTSW 8 89033058 small deletion probably benign
R6326:Sall1 UTSW 8 89030268 missense probably benign 0.09
R6920:Sall1 UTSW 8 89030393 missense probably damaging 1.00
R6954:Sall1 UTSW 8 89032891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAAGGGCTTCTCTCCAGTGTG -3'
(R):5'- TGCTTGTCAGAGTGCCTTGGAC -3'

Sequencing Primer
(F):5'- CTCGAAGAAGAGAAGGTTTTACCAC -3'
(R):5'- AGAGTGCCTTGGACATTCAC -3'
Posted On2013-04-11