Incidental Mutation 'R0089:Cenpt'
ID20067
Institutional Source Beutler Lab
Gene Symbol Cenpt
Ensembl Gene ENSMUSG00000036672
Gene Namecentromere protein T
Synonyms
MMRRC Submission 038376-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.662) question?
Stock #R0089 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105844673-105853278 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105846368 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 364 (T364A)
Ref Sequence ENSEMBL: ENSMUSP00000038188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034365] [ENSMUST00000040776] [ENSMUST00000212431] [ENSMUST00000212552] [ENSMUST00000212566] [ENSMUST00000212839]
Predicted Effect probably benign
Transcript: ENSMUST00000034365
SMART Domains Protein: ENSMUSP00000034365
Gene: ENSMUSG00000031893

DomainStartEndE-ValueType
Pfam:TSNAXIP1_N 98 209 3.5e-33 PFAM
coiled coil region 304 342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040776
AA Change: T364A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000038188
Gene: ENSMUSG00000036672
AA Change: T364A

DomainStartEndE-ValueType
Pfam:CENP-T_N 1 374 4.2e-174 PFAM
Pfam:CENP-T_C 404 507 5.4e-36 PFAM
Pfam:CENP-S 424 479 3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212357
Predicted Effect probably benign
Transcript: ENSMUST00000212431
Predicted Effect probably benign
Transcript: ENSMUST00000212552
Predicted Effect probably benign
Transcript: ENSMUST00000212566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212803
Predicted Effect probably benign
Transcript: ENSMUST00000212839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212873
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The centromere is a specialized chromatin domain, present throughout the cell cycle, that acts as a platform on which the transient assembly of the kinetochore occurs during mitosis. All active centromeres are characterized by the presence of long arrays of nucleosomes in which CENPA (MIM 117139) replaces histone H3 (see MIM 601128). CENPT is an additional factor required for centromere assembly (Foltz et al., 2006 [PubMed 16622419]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,292,886 V1583E possibly damaging Het
Ablim1 G T 19: 57,043,031 S654Y probably damaging Het
Acbd4 T C 11: 103,103,993 F59S probably damaging Het
Acot1 T C 12: 84,016,934 I272T probably damaging Het
Ankhd1 A G 18: 36,640,356 D1402G probably damaging Het
Birc6 T A 17: 74,638,376 F2800I possibly damaging Het
Brd1 T C 15: 88,701,198 E811G probably benign Het
Ccdc106 A G 7: 5,056,221 probably null Het
Ccdc81 G T 7: 89,893,116 A184E possibly damaging Het
Crybg2 T C 4: 134,081,194 S1060P probably damaging Het
Dnttip2 A G 3: 122,275,462 T109A possibly damaging Het
Dpy19l2 A G 9: 24,695,793 L124P probably benign Het
Fat3 T C 9: 15,938,205 D3967G probably benign Het
Fbxo21 T A 5: 118,008,143 F610L probably benign Het
Fmo9 T C 1: 166,667,309 D341G probably benign Het
Frem3 A T 8: 80,615,878 H1600L possibly damaging Het
Fry A T 5: 150,340,427 K133N possibly damaging Het
Gm10647 A G 9: 66,798,330 probably benign Het
Gm13124 T A 4: 144,555,733 H163L probably benign Het
Gm16432 C T 1: 178,046,989 P141S unknown Het
Gm21319 A T 12: 87,773,513 I92N probably damaging Het
Gmps T C 3: 63,998,698 F472S probably benign Het
Grb10 T C 11: 11,934,192 probably benign Het
Grm6 G A 11: 50,859,965 G652S probably damaging Het
Heca G T 10: 17,908,100 D468E probably damaging Het
Heg1 C T 16: 33,763,615 S1033L probably damaging Het
Hepacam2 A G 6: 3,487,094 S12P probably damaging Het
Impdh1 G T 6: 29,206,326 H195N probably benign Het
Ipo7 T C 7: 110,050,765 probably benign Het
Itpr2 C T 6: 146,350,022 probably null Het
Kcnh6 G A 11: 106,009,022 C39Y probably benign Het
Kif26a T C 12: 112,177,403 S1364P probably damaging Het
Lins1 T A 7: 66,712,048 probably benign Het
Lrpap1 C T 5: 35,094,888 V328M possibly damaging Het
Lyn T G 4: 3,748,768 L249V probably benign Het
Mpp7 A G 18: 7,439,555 probably benign Het
Mtmr9 A G 14: 63,528,247 F400L possibly damaging Het
Mto1 G A 9: 78,473,872 S666N probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nsg1 T C 5: 38,155,630 E75G probably benign Het
Nsun4 A G 4: 116,035,773 M283T probably benign Het
Obscn A G 11: 59,000,062 S7215P unknown Het
Olfr1042 A C 2: 86,159,574 S265R possibly damaging Het
Olfr1160 T C 2: 88,005,987 I264V probably damaging Het
Olfr1383 G A 11: 49,524,206 S161N possibly damaging Het
Olfr340 G A 2: 36,453,095 R170K probably benign Het
Olfr53 T C 7: 140,652,311 S111P probably damaging Het
Olfr677 T A 7: 105,057,090 Y281* probably null Het
Olfr736 T C 14: 50,392,864 I36T probably benign Het
Per1 T C 11: 69,104,043 F563S probably benign Het
Pik3c3 T A 18: 30,303,078 probably benign Het
Pitrm1 A T 13: 6,555,639 K207N probably damaging Het
Prdm10 C T 9: 31,316,230 R44C probably damaging Het
Rab40c A T 17: 25,885,148 I90N probably damaging Het
Rbl1 A G 2: 157,199,414 probably null Het
Rnf17 G A 14: 56,514,106 G1467E probably damaging Het
Rpgrip1 A G 14: 52,149,384 probably benign Het
Sall1 A T 8: 89,030,268 N1069K probably benign Het
Scap T C 9: 110,372,222 I93T possibly damaging Het
Sez6 T C 11: 77,974,344 probably benign Het
Slc22a30 A T 19: 8,370,197 S280T probably benign Het
Slc26a5 A C 5: 21,811,344 probably null Het
St18 T C 1: 6,848,948 V901A probably benign Het
Syne2 T C 12: 75,963,876 L2519P probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tmem51 T C 4: 142,031,925 T171A probably benign Het
Tns4 A T 11: 99,075,198 I453N probably damaging Het
Trank1 A T 9: 111,392,910 H2905L probably benign Het
Trim13 C T 14: 61,604,717 T61I possibly damaging Het
Trim75 T C 8: 64,982,928 Q290R possibly damaging Het
Ttn C A 2: 76,729,200 R29619L probably damaging Het
Ugt2b38 T A 5: 87,420,558 M293L probably benign Het
Vmn1r22 T A 6: 57,900,528 N155Y probably benign Het
Vmn2r18 T C 5: 151,584,804 Y285C probably benign Het
Vmn2r84 C T 10: 130,386,719 probably benign Het
Vwde A C 6: 13,220,005 L49R probably damaging Het
Yipf2 T A 9: 21,591,966 E68D possibly damaging Het
Zfand5 C A 19: 21,279,758 probably benign Het
Other mutations in Cenpt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Cenpt APN 8 105846665 missense possibly damaging 0.52
IGL01970:Cenpt APN 8 105845116 missense probably damaging 1.00
IGL03141:Cenpt APN 8 105851941 missense probably damaging 0.99
IGL03403:Cenpt APN 8 105849665 nonsense probably null
R0508:Cenpt UTSW 8 105849515 missense possibly damaging 0.81
R0648:Cenpt UTSW 8 105844960 missense probably damaging 0.99
R1460:Cenpt UTSW 8 105848888 missense probably damaging 1.00
R1839:Cenpt UTSW 8 105849014 missense possibly damaging 0.95
R4117:Cenpt UTSW 8 105849700 missense probably benign
R4732:Cenpt UTSW 8 105847136 missense probably benign 0.00
R4733:Cenpt UTSW 8 105847136 missense probably benign 0.00
R6246:Cenpt UTSW 8 105849259 missense possibly damaging 0.95
R6413:Cenpt UTSW 8 105846341 missense possibly damaging 0.64
R6582:Cenpt UTSW 8 105849201 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTGCTGTGCTTGACAATCATCC -3'
(R):5'- GGAAACTTCTGCTAGGCCAGGTAAG -3'

Sequencing Primer
(F):5'- GTGCTTGACAATCATCCGTATAGC -3'
(R):5'- GTCTTACAGAAGAGAATTTGCCCC -3'
Posted On2013-04-11