Incidental Mutation 'R0727:Pkhd1l1'
ID200679
Institutional Source Beutler Lab
Gene Symbol Pkhd1l1
Ensembl Gene ENSMUSG00000038725
Gene Namepolycystic kidney and hepatic disease 1-like 1
SynonymsPKHDL1, D86 mRNA, fibrocystin L
MMRRC Submission 038909-MU
Accession Numbers

Genbank: NM_138674; MGI: 2183153

Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R0727 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location44457494-44601369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44535788 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2083 (T2083A)
Ref Sequence ENSEMBL: ENSMUSP00000147447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038336] [ENSMUST00000166957] [ENSMUST00000209244]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038336
AA Change: T2083A

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036988
Gene: ENSMUSG00000038725
AA Change: T2083A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IPT 30 141 9.02e-3 SMART
Pfam:TIG 146 255 1.6e-16 PFAM
IPT 269 362 2.27e-8 SMART
PbH1 398 420 2.98e3 SMART
IPT 1066 1154 5.34e-5 SMART
IPT 1156 1235 1.44e-1 SMART
Pfam:TIG 1240 1322 1.1e-13 PFAM
IPT 1328 1407 7.06e0 SMART
Pfam:TIG 1565 1645 5.1e-11 PFAM
IPT 1657 1743 1.89e-5 SMART
Pfam:TIG 1748 1828 2.1e-10 PFAM
IPT 1829 1910 4.87e-8 SMART
IPT 1914 1997 6.84e-3 SMART
IPT 1998 2085 9.86e-1 SMART
IPT 2089 2176 7.21e-11 SMART
PbH1 2105 2126 1.56e3 SMART
G8 2183 2303 2.37e-59 SMART
PbH1 2484 2506 9.48e3 SMART
PbH1 2507 2529 8.45e2 SMART
PbH1 2565 2587 4.11e3 SMART
PbH1 2664 2686 3.5e3 SMART
PbH1 2732 2755 2.7e3 SMART
Blast:G8 2949 2979 1e-5 BLAST
low complexity region 3014 3025 N/A INTRINSIC
G8 3035 3173 6.5e-57 SMART
PbH1 3292 3314 1.96e3 SMART
PbH1 3354 3376 3.79e1 SMART
PbH1 3415 3437 4.87e2 SMART
PbH1 3470 3492 8.34e3 SMART
PbH1 3493 3514 5.86e3 SMART
low complexity region 3563 3574 N/A INTRINSIC
low complexity region 4076 4103 N/A INTRINSIC
low complexity region 4184 4212 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166957
AA Change: T2083A

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129522
Gene: ENSMUSG00000038725
AA Change: T2083A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IPT 30 141 9.02e-3 SMART
Pfam:TIG 146 255 9.4e-18 PFAM
IPT 269 362 2.27e-8 SMART
PbH1 398 420 2.98e3 SMART
IPT 1066 1154 5.34e-5 SMART
IPT 1156 1235 1.44e-1 SMART
Pfam:TIG 1240 1323 3e-13 PFAM
IPT 1328 1407 7.06e0 SMART
Pfam:TIG 1565 1645 3.7e-11 PFAM
IPT 1657 1743 1.89e-5 SMART
Pfam:TIG 1748 1828 9.7e-12 PFAM
IPT 1829 1910 4.87e-8 SMART
IPT 1914 1997 6.84e-3 SMART
IPT 1998 2085 9.86e-1 SMART
IPT 2089 2176 7.21e-11 SMART
PbH1 2105 2126 1.56e3 SMART
G8 2183 2303 2.37e-59 SMART
PbH1 2484 2506 9.48e3 SMART
PbH1 2507 2529 8.45e2 SMART
PbH1 2565 2587 4.11e3 SMART
PbH1 2664 2686 3.5e3 SMART
PbH1 2732 2755 2.7e3 SMART
Blast:G8 2949 2979 1e-5 BLAST
low complexity region 3014 3025 N/A INTRINSIC
G8 3035 3173 6.5e-57 SMART
PbH1 3292 3314 1.96e3 SMART
PbH1 3354 3376 3.79e1 SMART
PbH1 3415 3437 4.87e2 SMART
PbH1 3470 3492 8.34e3 SMART
PbH1 3493 3514 5.86e3 SMART
low complexity region 3563 3574 N/A INTRINSIC
low complexity region 4076 4103 N/A INTRINSIC
low complexity region 4184 4212 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209244
AA Change: T2083A

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231867
Meta Mutation Damage Score 0.046 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.1%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik A G 13: 98,984,227 V97A probably benign Het
2810474O19Rik A G 6: 149,325,822 N122S possibly damaging Het
Actr3b T C 5: 25,811,939 V83A possibly damaging Het
Adam2 A G 14: 66,029,731 I693T probably damaging Het
Adamts1 T C 16: 85,798,648 D214G possibly damaging Het
Atp6v1h T A 1: 5,084,558 Y36* probably null Het
Cacna1d A G 14: 30,130,115 probably null Het
Catsperb G T 12: 101,594,355 probably null Het
Ccdc88b T C 19: 6,854,214 M482V probably benign Het
Cemip T C 7: 83,961,578 K723E probably benign Het
Cep112 G A 11: 108,506,554 R375H probably damaging Het
Cpne7 T C 8: 123,126,286 S211P probably damaging Het
Csde1 A G 3: 103,043,638 T191A probably benign Het
Dapk3 A G 10: 81,190,262 Y129C probably damaging Het
Dlc1 A G 8: 36,572,674 V1027A probably damaging Het
Ergic2 T A 6: 148,199,400 probably benign Het
Evpl T C 11: 116,232,485 H307R probably damaging Het
Faah A G 4: 116,005,060 I242T probably damaging Het
Farsa T A 8: 84,861,304 probably null Het
Fat3 A C 9: 15,996,699 L2669R probably damaging Het
Fgfr4 C A 13: 55,156,228 probably null Het
Gnl3 A G 14: 31,017,077 S55P probably damaging Het
Grhl3 T A 4: 135,546,254 K562N possibly damaging Het
Hoxa9 A G 6: 52,224,314 V249A probably damaging Het
Hyal1 T C 9: 107,578,402 S304P possibly damaging Het
Igf1r T C 7: 68,212,158 probably null Het
Kif3c A G 12: 3,366,776 T266A probably benign Het
Lrp1b T C 2: 40,750,944 D3496G probably benign Het
Man2b1 T G 8: 85,091,526 V442G probably damaging Het
Mast1 T C 8: 84,921,415 Y479C probably damaging Het
Mei1 A G 15: 82,070,149 T52A probably benign Het
Micall1 A G 15: 79,120,778 D150G probably benign Het
Muc4 A G 16: 32,769,847 M2927V probably benign Het
Olfr1065 T C 2: 86,445,938 M15V probably benign Het
Olfr1082 A T 2: 86,594,380 Y149* probably null Het
Olfr1436 T C 19: 12,299,094 I13V probably benign Het
Olfr153 T A 2: 87,532,901 Y289* probably null Het
Olfr504 C T 7: 108,565,108 R229H probably benign Het
Olfr745 G T 14: 50,643,003 V241L probably damaging Het
Pabpc2 A C 18: 39,775,134 Q484P probably benign Het
Pbld2 T A 10: 63,067,519 V125D probably benign Het
Pum2 A G 12: 8,744,465 E785G probably damaging Het
Qser1 A G 2: 104,777,311 probably benign Het
R3hcc1l A G 19: 42,576,075 D29G probably damaging Het
Rabep1 T A 11: 70,900,492 Y180* probably null Het
Rassf5 T C 1: 131,181,265 S140G probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfpl4 T A 7: 5,115,293 I93L probably benign Het
Rnf219 G C 14: 104,480,188 L250V probably damaging Het
Ryr2 C T 13: 11,566,885 G4798D probably damaging Het
Scaf11 G A 15: 96,419,443 P747S probably damaging Het
Sgo2b T G 8: 63,927,782 K672T probably damaging Het
Smg1 T C 7: 118,166,422 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssh3 G T 19: 4,263,991 H439Q probably damaging Het
Steap3 T A 1: 120,227,817 T471S possibly damaging Het
Stk33 T A 7: 109,321,518 I208L probably damaging Het
Sucnr1 A G 3: 60,086,660 Y203C probably benign Het
Tlr11 T C 14: 50,361,469 I304T possibly damaging Het
Top2a A T 11: 99,012,148 C404* probably null Het
Trim43a G A 9: 88,582,146 E37K probably benign Het
Zcwpw1 T C 5: 137,810,807 probably benign Het
Zfhx4 A T 3: 5,401,073 H2097L probably damaging Het
Zfp874b T C 13: 67,474,712 K156E probably damaging Het
Zfyve16 T C 13: 92,493,878 K1413E possibly damaging Het
Other mutations in Pkhd1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Pkhd1l1 APN 15 44477586 missense probably damaging 1.00
IGL00235:Pkhd1l1 APN 15 44556019 missense probably damaging 1.00
IGL00264:Pkhd1l1 APN 15 44491029 missense possibly damaging 0.67
IGL00537:Pkhd1l1 APN 15 44591992 missense possibly damaging 0.88
IGL00537:Pkhd1l1 APN 15 44500047 missense probably benign 0.42
IGL00580:Pkhd1l1 APN 15 44586474 missense probably damaging 0.98
IGL01085:Pkhd1l1 APN 15 44562752 splice site probably null
IGL01089:Pkhd1l1 APN 15 44483869 splice site probably benign
IGL01094:Pkhd1l1 APN 15 44546929 missense probably benign 0.09
IGL01120:Pkhd1l1 APN 15 44505312 critical splice donor site probably null
IGL01307:Pkhd1l1 APN 15 44530029 missense possibly damaging 0.82
IGL01362:Pkhd1l1 APN 15 44532982 missense probably benign 0.00
IGL01403:Pkhd1l1 APN 15 44483833 nonsense probably null
IGL01546:Pkhd1l1 APN 15 44566316 missense probably damaging 1.00
IGL01596:Pkhd1l1 APN 15 44529410 missense possibly damaging 0.50
IGL01696:Pkhd1l1 APN 15 44529351 missense possibly damaging 0.79
IGL01844:Pkhd1l1 APN 15 44499400 splice site probably benign
IGL02007:Pkhd1l1 APN 15 44533733 splice site probably benign
IGL02041:Pkhd1l1 APN 15 44493056 splice site probably null
IGL02171:Pkhd1l1 APN 15 44516146 missense possibly damaging 0.80
IGL02206:Pkhd1l1 APN 15 44512849 missense probably benign 0.08
IGL02266:Pkhd1l1 APN 15 44573614 missense probably damaging 1.00
IGL02487:Pkhd1l1 APN 15 44459426 missense possibly damaging 0.65
IGL02488:Pkhd1l1 APN 15 44558597 missense probably benign
IGL02522:Pkhd1l1 APN 15 44555902 missense possibly damaging 0.71
IGL02554:Pkhd1l1 APN 15 44578500 missense probably damaging 1.00
IGL02566:Pkhd1l1 APN 15 44526054 splice site probably null
IGL02602:Pkhd1l1 APN 15 44557931 missense probably damaging 1.00
IGL02606:Pkhd1l1 APN 15 44589456 missense probably benign 0.00
IGL02623:Pkhd1l1 APN 15 44584873 missense probably damaging 1.00
IGL02634:Pkhd1l1 APN 15 44539667 missense probably damaging 1.00
IGL02637:Pkhd1l1 APN 15 44564324 missense probably damaging 1.00
IGL02651:Pkhd1l1 APN 15 44483814 missense probably damaging 1.00
IGL02679:Pkhd1l1 APN 15 44530045 critical splice donor site probably null
IGL02684:Pkhd1l1 APN 15 44516209 critical splice donor site probably null
IGL02739:Pkhd1l1 APN 15 44540950 missense probably benign 0.11
IGL02831:Pkhd1l1 APN 15 44501493 missense probably benign 0.18
IGL02839:Pkhd1l1 APN 15 44529543 missense probably damaging 0.98
IGL02944:Pkhd1l1 APN 15 44501531 missense probably damaging 1.00
IGL02957:Pkhd1l1 APN 15 44512908 missense probably damaging 1.00
IGL03001:Pkhd1l1 APN 15 44558004 missense probably damaging 1.00
IGL03030:Pkhd1l1 APN 15 44591976 missense probably benign 0.00
IGL03030:Pkhd1l1 APN 15 44596902 missense probably benign 0.41
IGL03132:Pkhd1l1 APN 15 44574617 missense probably damaging 1.00
IGL03194:Pkhd1l1 APN 15 44518135 missense probably damaging 1.00
IGL03219:Pkhd1l1 APN 15 44596895 missense possibly damaging 0.62
IGL03236:Pkhd1l1 APN 15 44581826 missense probably damaging 1.00
IGL03266:Pkhd1l1 APN 15 44538952 missense probably damaging 1.00
IGL03276:Pkhd1l1 APN 15 44594584 missense possibly damaging 0.77
IGL03284:Pkhd1l1 APN 15 44547518 splice site probably benign
IGL03377:Pkhd1l1 APN 15 44484351 splice site probably null
K7371:Pkhd1l1 UTSW 15 44537442 missense possibly damaging 0.67
K7371:Pkhd1l1 UTSW 15 44500067 missense possibly damaging 0.94
N/A - 287:Pkhd1l1 UTSW 15 44582258 missense probably damaging 0.98
P4717OSA:Pkhd1l1 UTSW 15 44523499 missense probably benign 0.17
P4717OSA:Pkhd1l1 UTSW 15 44528247 missense probably damaging 1.00
R0007:Pkhd1l1 UTSW 15 44574398 splice site probably benign
R0020:Pkhd1l1 UTSW 15 44556872 missense probably damaging 1.00
R0034:Pkhd1l1 UTSW 15 44504009 missense probably benign 0.00
R0040:Pkhd1l1 UTSW 15 44573625 missense probably damaging 1.00
R0050:Pkhd1l1 UTSW 15 44573807 missense possibly damaging 0.79
R0050:Pkhd1l1 UTSW 15 44573807 missense possibly damaging 0.79
R0063:Pkhd1l1 UTSW 15 44529237 missense probably damaging 1.00
R0063:Pkhd1l1 UTSW 15 44529237 missense probably damaging 1.00
R0086:Pkhd1l1 UTSW 15 44556008 missense possibly damaging 0.94
R0103:Pkhd1l1 UTSW 15 44597141 missense probably benign
R0103:Pkhd1l1 UTSW 15 44597141 missense probably benign
R0127:Pkhd1l1 UTSW 15 44554605 missense probably damaging 0.99
R0226:Pkhd1l1 UTSW 15 44526784 missense possibly damaging 0.65
R0268:Pkhd1l1 UTSW 15 44597011 missense probably benign 0.15
R0294:Pkhd1l1 UTSW 15 44560435 missense probably benign 0.05
R0310:Pkhd1l1 UTSW 15 44522738 splice site probably benign
R0344:Pkhd1l1 UTSW 15 44597011 missense probably benign 0.15
R0449:Pkhd1l1 UTSW 15 44501519 missense probably damaging 1.00
R0492:Pkhd1l1 UTSW 15 44519690 missense probably benign 0.03
R0505:Pkhd1l1 UTSW 15 44589418 missense probably damaging 1.00
R0529:Pkhd1l1 UTSW 15 44526754 missense possibly damaging 0.62
R0543:Pkhd1l1 UTSW 15 44523491 critical splice acceptor site probably null
R0552:Pkhd1l1 UTSW 15 44489546 missense probably damaging 0.98
R0558:Pkhd1l1 UTSW 15 44484424 missense probably damaging 0.97
R0609:Pkhd1l1 UTSW 15 44467424 missense possibly damaging 0.48
R0619:Pkhd1l1 UTSW 15 44483838 missense probably damaging 1.00
R0787:Pkhd1l1 UTSW 15 44529264 missense probably damaging 1.00
R0846:Pkhd1l1 UTSW 15 44495597 missense probably damaging 1.00
R0909:Pkhd1l1 UTSW 15 44538883 splice site probably null
R0942:Pkhd1l1 UTSW 15 44532959 missense probably benign 0.01
R1056:Pkhd1l1 UTSW 15 44591964 missense probably damaging 1.00
R1147:Pkhd1l1 UTSW 15 44537441 missense probably null 0.15
R1147:Pkhd1l1 UTSW 15 44537441 missense probably null 0.15
R1187:Pkhd1l1 UTSW 15 44498051 missense possibly damaging 0.65
R1328:Pkhd1l1 UTSW 15 44497996 missense probably benign 0.01
R1331:Pkhd1l1 UTSW 15 44505547 missense probably damaging 1.00
R1331:Pkhd1l1 UTSW 15 44589597 missense probably damaging 1.00
R1332:Pkhd1l1 UTSW 15 44505547 missense probably damaging 1.00
R1335:Pkhd1l1 UTSW 15 44505547 missense probably damaging 1.00
R1338:Pkhd1l1 UTSW 15 44526724 missense probably damaging 1.00
R1440:Pkhd1l1 UTSW 15 44540988 splice site probably benign
R1445:Pkhd1l1 UTSW 15 44505644 missense probably benign 0.32
R1458:Pkhd1l1 UTSW 15 44516115 missense probably benign 0.01
R1469:Pkhd1l1 UTSW 15 44536886 missense probably benign 0.45
R1469:Pkhd1l1 UTSW 15 44536886 missense probably benign 0.45
R1500:Pkhd1l1 UTSW 15 44545494 missense probably damaging 1.00
R1528:Pkhd1l1 UTSW 15 44526724 missense probably damaging 1.00
R1542:Pkhd1l1 UTSW 15 44528191 missense probably benign 0.44
R1568:Pkhd1l1 UTSW 15 44545501 splice site probably null
R1571:Pkhd1l1 UTSW 15 44526841 missense probably benign
R1572:Pkhd1l1 UTSW 15 44543473 missense probably benign 0.01
R1604:Pkhd1l1 UTSW 15 44467367 nonsense probably null
R1638:Pkhd1l1 UTSW 15 44597117 missense probably benign 0.06
R1639:Pkhd1l1 UTSW 15 44540955 missense probably damaging 0.99
R1737:Pkhd1l1 UTSW 15 44547509 critical splice donor site probably null
R1816:Pkhd1l1 UTSW 15 44528239 missense possibly damaging 0.91
R1826:Pkhd1l1 UTSW 15 44503345 missense possibly damaging 0.75
R1880:Pkhd1l1 UTSW 15 44525242 missense probably benign 0.13
R1930:Pkhd1l1 UTSW 15 44503337 missense possibly damaging 0.69
R1933:Pkhd1l1 UTSW 15 44540884 missense possibly damaging 0.48
R1938:Pkhd1l1 UTSW 15 44500038 missense probably benign
R1975:Pkhd1l1 UTSW 15 44529713 missense probably damaging 1.00
R1999:Pkhd1l1 UTSW 15 44499982 intron probably null
R2037:Pkhd1l1 UTSW 15 44568221 splice site probably null
R2045:Pkhd1l1 UTSW 15 44479654 missense probably damaging 1.00
R2049:Pkhd1l1 UTSW 15 44547513 splice site probably benign
R2049:Pkhd1l1 UTSW 15 44581741 missense probably damaging 1.00
R2063:Pkhd1l1 UTSW 15 44550752 missense possibly damaging 0.69
R2072:Pkhd1l1 UTSW 15 44558639 missense probably damaging 1.00
R2073:Pkhd1l1 UTSW 15 44558639 missense probably damaging 1.00
R2075:Pkhd1l1 UTSW 15 44558639 missense probably damaging 1.00
R2078:Pkhd1l1 UTSW 15 44527767 missense probably benign 0.08
R2116:Pkhd1l1 UTSW 15 44569482 missense probably damaging 0.97
R2133:Pkhd1l1 UTSW 15 44516185 missense possibly damaging 0.91
R2138:Pkhd1l1 UTSW 15 44501457 missense probably damaging 1.00
R2139:Pkhd1l1 UTSW 15 44529818 missense possibly damaging 0.46
R2145:Pkhd1l1 UTSW 15 44512877 synonymous probably null
R2150:Pkhd1l1 UTSW 15 44499982 intron probably null
R2177:Pkhd1l1 UTSW 15 44459395 missense probably benign
R2184:Pkhd1l1 UTSW 15 44499296 missense possibly damaging 0.89
R2216:Pkhd1l1 UTSW 15 44573895 missense probably damaging 1.00
R2226:Pkhd1l1 UTSW 15 44512792 missense possibly damaging 0.79
R2227:Pkhd1l1 UTSW 15 44512792 missense possibly damaging 0.79
R2243:Pkhd1l1 UTSW 15 44546927 missense probably damaging 1.00
R2290:Pkhd1l1 UTSW 15 44528250 missense probably benign 0.03
R2294:Pkhd1l1 UTSW 15 44479607 missense probably damaging 0.99
R2346:Pkhd1l1 UTSW 15 44560506 missense possibly damaging 0.82
R2356:Pkhd1l1 UTSW 15 44533019 missense probably benign 0.00
R2386:Pkhd1l1 UTSW 15 44528178 missense probably benign 0.00
R2404:Pkhd1l1 UTSW 15 44550820 missense probably damaging 1.00
R2504:Pkhd1l1 UTSW 15 44485428 missense probably damaging 0.97
R2679:Pkhd1l1 UTSW 15 44545386 missense probably damaging 0.99
R2860:Pkhd1l1 UTSW 15 44540871 missense probably damaging 1.00
R2861:Pkhd1l1 UTSW 15 44540871 missense probably damaging 1.00
R2862:Pkhd1l1 UTSW 15 44540871 missense probably damaging 1.00
R2972:Pkhd1l1 UTSW 15 44547248 missense possibly damaging 0.65
R3016:Pkhd1l1 UTSW 15 44545370 missense probably benign 0.02
R3162:Pkhd1l1 UTSW 15 44505528 missense probably damaging 1.00
R3162:Pkhd1l1 UTSW 15 44505528 missense probably damaging 1.00
R3416:Pkhd1l1 UTSW 15 44547364 missense probably damaging 1.00
R3623:Pkhd1l1 UTSW 15 44526869 missense probably damaging 1.00
R3687:Pkhd1l1 UTSW 15 44546587 missense probably benign 0.17
R3755:Pkhd1l1 UTSW 15 44589406 missense probably damaging 1.00
R3776:Pkhd1l1 UTSW 15 44514975 critical splice donor site probably null
R3803:Pkhd1l1 UTSW 15 44493135 missense probably benign 0.25
R3942:Pkhd1l1 UTSW 15 44592026 critical splice donor site probably null
R4010:Pkhd1l1 UTSW 15 44529100 missense possibly damaging 0.80
R4049:Pkhd1l1 UTSW 15 44498557 missense probably damaging 1.00
R4059:Pkhd1l1 UTSW 15 44550760 missense probably benign 0.01
R4179:Pkhd1l1 UTSW 15 44523649 missense probably benign 0.45
R4184:Pkhd1l1 UTSW 15 44591906 missense probably benign 0.00
R4369:Pkhd1l1 UTSW 15 44505553 missense probably benign 0.00
R4462:Pkhd1l1 UTSW 15 44581804 missense probably damaging 1.00
R4551:Pkhd1l1 UTSW 15 44550885 missense probably damaging 1.00
R4618:Pkhd1l1 UTSW 15 44539682 missense probably damaging 1.00
R4632:Pkhd1l1 UTSW 15 44484400 missense probably benign 0.07
R4657:Pkhd1l1 UTSW 15 44547347 missense probably damaging 1.00
R4716:Pkhd1l1 UTSW 15 44556032 missense probably damaging 1.00
R4788:Pkhd1l1 UTSW 15 44498021 missense probably damaging 0.99
R4828:Pkhd1l1 UTSW 15 44529405 missense possibly damaging 0.55
R4858:Pkhd1l1 UTSW 15 44491101 missense probably damaging 0.99
R4860:Pkhd1l1 UTSW 15 44537378 missense possibly damaging 0.77
R4860:Pkhd1l1 UTSW 15 44537378 missense possibly damaging 0.77
R4951:Pkhd1l1 UTSW 15 44533891 missense possibly damaging 0.82
R4963:Pkhd1l1 UTSW 15 44504025 missense probably benign 0.00
R5023:Pkhd1l1 UTSW 15 44528191 missense probably benign 0.44
R5023:Pkhd1l1 UTSW 15 44582227 missense probably benign 0.00
R5035:Pkhd1l1 UTSW 15 44568324 missense probably damaging 1.00
R5049:Pkhd1l1 UTSW 15 44457616 missense probably benign 0.00
R5065:Pkhd1l1 UTSW 15 44582293 missense possibly damaging 0.68
R5089:Pkhd1l1 UTSW 15 44591887 missense probably benign 0.01
R5151:Pkhd1l1 UTSW 15 44505309 missense probably benign 0.00
R5153:Pkhd1l1 UTSW 15 44505309 missense probably benign 0.00
R5189:Pkhd1l1 UTSW 15 44547148 missense probably damaging 1.00
R5204:Pkhd1l1 UTSW 15 44547041 missense possibly damaging 0.51
R5216:Pkhd1l1 UTSW 15 44495647 nonsense probably null
R5286:Pkhd1l1 UTSW 15 44514972 nonsense probably null
R5292:Pkhd1l1 UTSW 15 44529566 missense probably damaging 1.00
R5293:Pkhd1l1 UTSW 15 44535750 missense probably benign 0.01
R5298:Pkhd1l1 UTSW 15 44504046 missense probably benign 0.00
R5327:Pkhd1l1 UTSW 15 44546862 missense probably damaging 1.00
R5346:Pkhd1l1 UTSW 15 44540967 missense probably damaging 1.00
R5481:Pkhd1l1 UTSW 15 44558646 missense probably damaging 1.00
R5645:Pkhd1l1 UTSW 15 44532992 missense probably benign 0.18
R5718:Pkhd1l1 UTSW 15 44545417 missense probably damaging 1.00
R5809:Pkhd1l1 UTSW 15 44519707 missense probably benign 0.03
R5816:Pkhd1l1 UTSW 15 44566322 missense probably benign 0.01
R5854:Pkhd1l1 UTSW 15 44581790 missense probably damaging 1.00
R5876:Pkhd1l1 UTSW 15 44578588 missense possibly damaging 0.51
R5909:Pkhd1l1 UTSW 15 44526763 missense probably damaging 1.00
R5950:Pkhd1l1 UTSW 15 44532965 missense probably benign 0.00
R5961:Pkhd1l1 UTSW 15 44459463 missense probably damaging 1.00
R5972:Pkhd1l1 UTSW 15 44545416 missense probably damaging 1.00
R5975:Pkhd1l1 UTSW 15 44525988 missense probably damaging 1.00
R5982:Pkhd1l1 UTSW 15 44489504 splice site probably null
R6066:Pkhd1l1 UTSW 15 44528129 missense probably damaging 0.99
R6122:Pkhd1l1 UTSW 15 44557940 missense probably damaging 1.00
R6248:Pkhd1l1 UTSW 15 44529559 missense probably benign
R6294:Pkhd1l1 UTSW 15 44570028 missense probably damaging 1.00
R6301:Pkhd1l1 UTSW 15 44589525 missense probably damaging 0.99
R6526:Pkhd1l1 UTSW 15 44498089 critical splice donor site probably null
R6707:Pkhd1l1 UTSW 15 44529143 missense probably benign
R6736:Pkhd1l1 UTSW 15 44557940 missense probably damaging 1.00
R6753:Pkhd1l1 UTSW 15 44589663 missense probably benign 0.45
R6815:Pkhd1l1 UTSW 15 44562655 missense probably damaging 1.00
R6874:Pkhd1l1 UTSW 15 44589527 missense probably benign 0.06
R6942:Pkhd1l1 UTSW 15 44522629 missense probably damaging 1.00
R6970:Pkhd1l1 UTSW 15 44511674 missense possibly damaging 0.61
R6982:Pkhd1l1 UTSW 15 44566268 missense probably damaging 0.97
X0027:Pkhd1l1 UTSW 15 44591966 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGGTTGTAAGTCTCAACACTGGC -3'
(R):5'- TTACTGTGAGGCACAGACGAGAGC -3'

Sequencing Primer
(F):5'- CTAGTTCTGCAAAACTAAGCTGGAAG -3'
(R):5'- GAGCAAGTACAACACCTTGCATC -3'
Posted On2014-05-23