Incidental Mutation 'R1344:Sec24b'
ID200707
Institutional Source Beutler Lab
Gene Symbol Sec24b
Ensembl Gene ENSMUSG00000001052
Gene NameSec24 related gene family, member B (S. cerevisiae)
SynonymsSEC24
MMRRC Submission 039409-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.685) question?
Stock #R1344 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location129982759-130061553 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130007423 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 408 (N408S)
Ref Sequence ENSEMBL: ENSMUSP00000126923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001079] [ENSMUST00000165873] [ENSMUST00000168644]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001079
AA Change: N537S

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000001079
Gene: ENSMUSG00000001052
AA Change: N537S

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 127 143 N/A INTRINSIC
low complexity region 229 254 N/A INTRINSIC
low complexity region 316 333 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
low complexity region 363 373 N/A INTRINSIC
low complexity region 378 386 N/A INTRINSIC
low complexity region 419 444 N/A INTRINSIC
low complexity region 450 473 N/A INTRINSIC
low complexity region 486 505 N/A INTRINSIC
low complexity region 555 568 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 585 622 4.1e-17 PFAM
Pfam:Sec23_trunk 658 897 2.4e-87 PFAM
Pfam:Sec23_BS 902 986 3.4e-23 PFAM
Pfam:Sec23_helical 999 1099 8.7e-31 PFAM
Pfam:Gelsolin 1122 1197 4.9e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165873
AA Change: N274S

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132861
Gene: ENSMUSG00000001052
AA Change: N274S

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
low complexity region 88 105 N/A INTRINSIC
low complexity region 115 123 N/A INTRINSIC
low complexity region 156 181 N/A INTRINSIC
low complexity region 187 210 N/A INTRINSIC
low complexity region 223 242 N/A INTRINSIC
low complexity region 292 305 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 321 359 2.5e-18 PFAM
Pfam:Sec23_trunk 395 634 1.6e-87 PFAM
Pfam:Sec23_BS 639 723 2.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165889
Predicted Effect probably damaging
Transcript: ENSMUST00000168644
AA Change: N408S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126923
Gene: ENSMUSG00000001052
AA Change: N408S

DomainStartEndE-ValueType
low complexity region 93 118 N/A INTRINSIC
low complexity region 180 197 N/A INTRINSIC
low complexity region 249 257 N/A INTRINSIC
low complexity region 290 315 N/A INTRINSIC
low complexity region 321 344 N/A INTRINSIC
low complexity region 357 376 N/A INTRINSIC
PDB:3EH1|A 377 411 1e-11 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168908
Meta Mutation Damage Score 0.342 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein is thought to be a cargo-binding component of the COPII vesicle, and is thought to be involved in the transport of secretory proteins from the endoplasmic reticulum to the Golgi apparatus. Mutations in this gene have been associated with neural tube defects, and are thought to be a result of a disruption in interactions with the protein encoded by the VANGL planar cell polarity protein 2 (VANGL2) gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit craniorachischisis, abnormal embryo shape, omphalocele, disoriented hair cells, and failure of eyelid fusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik T G 6: 52,179,151 probably benign Het
Aco1 T C 4: 40,179,008 Y336H probably damaging Het
Adamts12 T A 15: 11,286,804 W832R probably damaging Het
Asxl2 A G 12: 3,493,790 K320E probably damaging Het
Atrnl1 G A 19: 57,935,705 probably null Het
B4galnt2 A C 11: 95,869,355 I282S probably benign Het
Bcl2l13 T C 6: 120,876,327 I191T probably benign Het
Cd101 A T 3: 101,018,775 Y209* probably null Het
Cd109 A T 9: 78,672,550 probably null Het
Cdc34 G A 10: 79,685,300 A128T probably damaging Het
Cdk12 T A 11: 98,241,785 S1013R unknown Het
Cntd1 T A 11: 101,285,740 L221Q possibly damaging Het
Cntn4 G A 6: 106,344,870 probably null Het
Col12a1 T A 9: 79,699,555 K529* probably null Het
Col17a1 T A 19: 47,671,505 D336V probably damaging Het
Creb3l4 A G 3: 90,238,738 I193T possibly damaging Het
Cyp2d10 A T 15: 82,405,905 probably null Het
Dcun1d3 A G 7: 119,857,935 F185L probably damaging Het
Dlec1 G A 9: 119,130,017 E910K probably benign Het
Dnajc19 T A 3: 34,058,012 N128I probably damaging Het
Dusp1 A G 17: 26,508,319 V2A probably benign Het
Eea1 G A 10: 95,994,999 probably null Het
Elf1 T C 14: 79,560,775 V34A probably damaging Het
Extl1 T C 4: 134,359,241 D501G probably damaging Het
Fam160b1 G A 19: 57,371,162 A45T possibly damaging Het
Fam198a A T 9: 121,978,386 H532L probably damaging Het
Fcgr2b T C 1: 170,961,081 Y319C probably damaging Het
Fxr2 A G 11: 69,648,884 H247R possibly damaging Het
Gfra1 A C 19: 58,238,417 S461A possibly damaging Het
Gli2 T G 1: 118,841,936 I629L probably damaging Het
Gm21671 T A 5: 25,953,109 T82S probably benign Het
Gm6614 A G 6: 141,985,618 S474P probably damaging Het
Gpx3 G A 11: 54,909,596 V207I probably damaging Het
Helz2 T C 2: 181,237,596 D743G possibly damaging Het
Hormad2 A G 11: 4,409,005 probably null Het
Ifitm1 C T 7: 140,968,350 T32M probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Lrit2 A G 14: 37,068,556 N64S probably benign Het
Lsm14a A T 7: 34,353,557 D322E probably damaging Het
Macf1 T G 4: 123,433,453 R4752S probably damaging Het
Mark3 T C 12: 111,627,837 I307T possibly damaging Het
Mpdz T A 4: 81,308,319 T1360S probably benign Het
Mtif2 G A 11: 29,545,002 V701I probably benign Het
Myh3 A G 11: 67,092,332 E895G probably benign Het
Ncan A C 8: 70,108,169 I716R probably benign Het
Ncor2 C T 5: 125,025,446 R1867K probably damaging Het
Oas1d C T 5: 120,914,896 L5F probably damaging Het
Olfr399 A T 11: 74,054,212 C182* probably null Het
Olfr45 T C 7: 140,691,799 V298A probably damaging Het
Olfr747 T A 14: 50,680,858 M259L probably benign Het
Olfr982 T A 9: 40,074,472 L59H probably damaging Het
Otog G T 7: 46,274,615 A1133S probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd11 A G 19: 47,130,077 D1794G probably damaging Het
Pde1c T C 6: 56,361,767 I27V probably benign Het
Pde4d C A 13: 109,950,387 S609* probably null Het
Piezo2 T A 18: 63,021,254 I2485F probably damaging Het
Plekhd1 A G 12: 80,692,885 T3A probably benign Het
Plscr1 C T 9: 92,259,304 T15I unknown Het
Rd3 T C 1: 191,985,301 *106R probably null Het
Rnf125 A G 18: 20,981,231 I97V possibly damaging Het
Sf3b3 G C 8: 110,838,303 A291G probably damaging Het
Simc1 T C 13: 54,550,479 V403A probably damaging Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Slitrk5 A G 14: 111,680,389 S482G probably benign Het
Smyd1 G A 6: 71,262,167 T13I probably benign Het
Stoml2 T A 4: 43,028,197 I344F probably benign Het
Tet1 C T 10: 62,814,521 R1636H probably damaging Het
Thap12 A G 7: 98,716,830 D735G probably damaging Het
Tnip3 T C 6: 65,597,429 V88A probably benign Het
Ttn A G 2: 76,735,411 V28199A possibly damaging Het
Ube3b T C 5: 114,418,575 F989S probably damaging Het
Ubox5 A G 2: 130,600,290 L159P probably damaging Het
Uevld A T 7: 46,938,010 V314E possibly damaging Het
Uhrf1bp1 A G 17: 27,894,577 K1241R probably benign Het
Urb1 T C 16: 90,769,466 M1478V probably damaging Het
Ust C A 10: 8,298,190 V184F possibly damaging Het
Wdr95 G A 5: 149,588,098 C421Y probably damaging Het
Other mutations in Sec24b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Sec24b APN 3 130020646 intron probably benign
IGL01137:Sec24b APN 3 130007444 missense probably benign 0.02
IGL01370:Sec24b APN 3 130007604 splice site probably benign
IGL01931:Sec24b APN 3 130009799 missense probably benign 0.00
R0193:Sec24b UTSW 3 129988984 missense probably null
R0194:Sec24b UTSW 3 129984165 critical splice donor site probably null
R0403:Sec24b UTSW 3 129989676 missense possibly damaging 0.81
R0403:Sec24b UTSW 3 129999534 missense probably damaging 1.00
R0576:Sec24b UTSW 3 130041336 missense probably benign 0.11
R0583:Sec24b UTSW 3 130041311 nonsense probably null
R0963:Sec24b UTSW 3 130040905 missense probably benign 0.02
R0967:Sec24b UTSW 3 129996782 missense probably damaging 1.00
R1418:Sec24b UTSW 3 130007423 missense probably damaging 1.00
R1594:Sec24b UTSW 3 129991351 missense probably benign 0.00
R1716:Sec24b UTSW 3 130041016 missense possibly damaging 0.89
R1938:Sec24b UTSW 3 129991361 missense possibly damaging 0.82
R2020:Sec24b UTSW 3 129987728 missense probably damaging 1.00
R2407:Sec24b UTSW 3 130002316 missense probably benign 0.02
R2415:Sec24b UTSW 3 129996080 missense probably benign 0.00
R3121:Sec24b UTSW 3 130002304 critical splice donor site probably null
R3729:Sec24b UTSW 3 130033833 missense possibly damaging 0.95
R3731:Sec24b UTSW 3 130033833 missense possibly damaging 0.95
R3789:Sec24b UTSW 3 130020627 missense probably benign 0.00
R4229:Sec24b UTSW 3 130040719 missense probably benign 0.24
R4230:Sec24b UTSW 3 130040719 missense probably benign 0.24
R4617:Sec24b UTSW 3 130040764 missense possibly damaging 0.94
R4856:Sec24b UTSW 3 129983970 missense probably benign 0.07
R4886:Sec24b UTSW 3 129983970 missense probably benign 0.07
R4913:Sec24b UTSW 3 130002379 missense probably benign 0.07
R5510:Sec24b UTSW 3 130040895 missense probably damaging 1.00
R5601:Sec24b UTSW 3 130040834 small insertion probably benign
R6167:Sec24b UTSW 3 129988901 missense possibly damaging 0.88
R6314:Sec24b UTSW 3 130007245 unclassified probably null
R6442:Sec24b UTSW 3 129996701 missense probably damaging 1.00
R6512:Sec24b UTSW 3 130041297 missense probably damaging 1.00
R6743:Sec24b UTSW 3 130041232 missense probably damaging 0.98
X0065:Sec24b UTSW 3 129996355 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCTCCAAGGACTACAGCAACGTG -3'
(R):5'- CAGCATTACCCAGGTGTGAACCAG -3'

Sequencing Primer
(F):5'- cacacaccacaacccaaac -3'
(R):5'- AGCTGTCCTCAGGTCTCG -3'
Posted On2014-05-23