Incidental Mutation 'R1344:Pde1c'
ID200720
Institutional Source Beutler Lab
Gene Symbol Pde1c
Ensembl Gene ENSMUSG00000004347
Gene Namephosphodiesterase 1C
Synonyms
MMRRC Submission 039409-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R1344 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location56069804-56569103 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56361767 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 27 (I27V)
Ref Sequence ENSEMBL: ENSMUSP00000128364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044505] [ENSMUST00000114327] [ENSMUST00000164037] [ENSMUST00000164752] [ENSMUST00000166102] [ENSMUST00000166890] [ENSMUST00000168944] [ENSMUST00000170774] [ENSMUST00000203372]
Predicted Effect probably benign
Transcript: ENSMUST00000044505
AA Change: I27V

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000046601
Gene: ENSMUSG00000004347
AA Change: I27V

DomainStartEndE-ValueType
Pfam:PDEase_I_N 82 142 3.8e-34 PFAM
HDc 225 390 1.02e-5 SMART
Blast:HDc 402 681 1e-123 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114327
AA Change: I27V

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000109966
Gene: ENSMUSG00000004347
AA Change: I27V

DomainStartEndE-ValueType
Pfam:PDEase_I_N 82 142 4.7e-31 PFAM
HDc 225 390 1.02e-5 SMART
Blast:HDc 402 650 1e-110 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164037
AA Change: I27V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000130139
Gene: ENSMUSG00000004347
AA Change: I27V

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 8e-32 PFAM
HDc 216 381 1.02e-5 SMART
Blast:HDc 393 618 1e-102 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164752
AA Change: I27V

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000129185
Gene: ENSMUSG00000004347
AA Change: I27V

DomainStartEndE-ValueType
Pfam:PDEase_I_N 82 142 3e-28 PFAM
HDc 225 390 5.7e-8 SMART
Blast:HDc 402 627 1e-101 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000166102
AA Change: I27V

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131350
Gene: ENSMUSG00000004347
AA Change: I27V

DomainStartEndE-ValueType
Pfam:PDEase_I_N 82 142 3e-28 PFAM
HDc 225 390 5.7e-8 SMART
Blast:HDc 402 627 1e-101 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000166890
SMART Domains Protein: ENSMUSP00000131892
Gene: ENSMUSG00000004347

DomainStartEndE-ValueType
Pfam:PDEase_I_N 54 114 3.5e-31 PFAM
HDc 197 362 1.02e-5 SMART
Blast:HDc 374 599 1e-102 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000168944
AA Change: I27V

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128364
Gene: ENSMUSG00000004347
AA Change: I27V

DomainStartEndE-ValueType
Pfam:PDEase_I_N 82 142 4.7e-31 PFAM
HDc 225 390 1.02e-5 SMART
Blast:HDc 402 650 1e-110 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000170774
SMART Domains Protein: ENSMUSP00000133170
Gene: ENSMUSG00000004347

DomainStartEndE-ValueType
Pfam:PDEase_I_N 45 105 3.6e-31 PFAM
HDc 188 353 1.02e-5 SMART
Blast:HDc 365 613 1e-110 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000203372
SMART Domains Protein: ENSMUSP00000145508
Gene: ENSMUSG00000004347

DomainStartEndE-ValueType
Pfam:PDEase_I_N 142 202 3.1e-31 PFAM
HDc 285 450 5.8e-8 SMART
Blast:HDc 462 741 1e-122 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204821
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to the 3'5'-cyclic nucleotide phosphodiesterase family. Members of this family catalyze hydrolysis of the cyclic nucleotides, cyclic adenosine monophosphate and cyclic guanosine monophosphate, to the corresponding nucleoside 5'-monophosphates. The enzyme encoded by this gene regulates proliferation and migration of vascular smooth muscle cells, and neointimal hyperplasia. This enzyme also plays a role in pathological vascular remodeling by regulating the stability of growth factor receptors, such as PDGF-receptor-beta. [provided by RefSeq, Jul 2016]
PHENOTYPE: Olfactory sensory nerves from homozygous null mice have significantly reduced action potentials in response to odor with slower onset kinetics and a faster response termination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik T G 6: 52,179,151 probably benign Het
Aco1 T C 4: 40,179,008 Y336H probably damaging Het
Adamts12 T A 15: 11,286,804 W832R probably damaging Het
Asxl2 A G 12: 3,493,790 K320E probably damaging Het
Atrnl1 G A 19: 57,935,705 probably null Het
B4galnt2 A C 11: 95,869,355 I282S probably benign Het
Bcl2l13 T C 6: 120,876,327 I191T probably benign Het
Cd101 A T 3: 101,018,775 Y209* probably null Het
Cd109 A T 9: 78,672,550 probably null Het
Cdc34 G A 10: 79,685,300 A128T probably damaging Het
Cdk12 T A 11: 98,241,785 S1013R unknown Het
Cntd1 T A 11: 101,285,740 L221Q possibly damaging Het
Cntn4 G A 6: 106,344,870 probably null Het
Col12a1 T A 9: 79,699,555 K529* probably null Het
Col17a1 T A 19: 47,671,505 D336V probably damaging Het
Creb3l4 A G 3: 90,238,738 I193T possibly damaging Het
Cyp2d10 A T 15: 82,405,905 probably null Het
Dcun1d3 A G 7: 119,857,935 F185L probably damaging Het
Dlec1 G A 9: 119,130,017 E910K probably benign Het
Dnajc19 T A 3: 34,058,012 N128I probably damaging Het
Dusp1 A G 17: 26,508,319 V2A probably benign Het
Eea1 G A 10: 95,994,999 probably null Het
Elf1 T C 14: 79,560,775 V34A probably damaging Het
Extl1 T C 4: 134,359,241 D501G probably damaging Het
Fam160b1 G A 19: 57,371,162 A45T possibly damaging Het
Fam198a A T 9: 121,978,386 H532L probably damaging Het
Fcgr2b T C 1: 170,961,081 Y319C probably damaging Het
Fxr2 A G 11: 69,648,884 H247R possibly damaging Het
Gfra1 A C 19: 58,238,417 S461A possibly damaging Het
Gli2 T G 1: 118,841,936 I629L probably damaging Het
Gm21671 T A 5: 25,953,109 T82S probably benign Het
Gm6614 A G 6: 141,985,618 S474P probably damaging Het
Gpx3 G A 11: 54,909,596 V207I probably damaging Het
Helz2 T C 2: 181,237,596 D743G possibly damaging Het
Hormad2 A G 11: 4,409,005 probably null Het
Ifitm1 C T 7: 140,968,350 T32M probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Lrit2 A G 14: 37,068,556 N64S probably benign Het
Lsm14a A T 7: 34,353,557 D322E probably damaging Het
Macf1 T G 4: 123,433,453 R4752S probably damaging Het
Mark3 T C 12: 111,627,837 I307T possibly damaging Het
Mpdz T A 4: 81,308,319 T1360S probably benign Het
Mtif2 G A 11: 29,545,002 V701I probably benign Het
Myh3 A G 11: 67,092,332 E895G probably benign Het
Ncan A C 8: 70,108,169 I716R probably benign Het
Ncor2 C T 5: 125,025,446 R1867K probably damaging Het
Oas1d C T 5: 120,914,896 L5F probably damaging Het
Olfr399 A T 11: 74,054,212 C182* probably null Het
Olfr45 T C 7: 140,691,799 V298A probably damaging Het
Olfr747 T A 14: 50,680,858 M259L probably benign Het
Olfr982 T A 9: 40,074,472 L59H probably damaging Het
Otog G T 7: 46,274,615 A1133S probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd11 A G 19: 47,130,077 D1794G probably damaging Het
Pde4d C A 13: 109,950,387 S609* probably null Het
Piezo2 T A 18: 63,021,254 I2485F probably damaging Het
Plekhd1 A G 12: 80,692,885 T3A probably benign Het
Plscr1 C T 9: 92,259,304 T15I unknown Het
Rd3 T C 1: 191,985,301 *106R probably null Het
Rnf125 A G 18: 20,981,231 I97V possibly damaging Het
Sec24b T C 3: 130,007,423 N408S probably damaging Het
Sf3b3 G C 8: 110,838,303 A291G probably damaging Het
Simc1 T C 13: 54,550,479 V403A probably damaging Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Slitrk5 A G 14: 111,680,389 S482G probably benign Het
Smyd1 G A 6: 71,262,167 T13I probably benign Het
Stoml2 T A 4: 43,028,197 I344F probably benign Het
Tet1 C T 10: 62,814,521 R1636H probably damaging Het
Thap12 A G 7: 98,716,830 D735G probably damaging Het
Tnip3 T C 6: 65,597,429 V88A probably benign Het
Ttn A G 2: 76,735,411 V28199A possibly damaging Het
Ube3b T C 5: 114,418,575 F989S probably damaging Het
Ubox5 A G 2: 130,600,290 L159P probably damaging Het
Uevld A T 7: 46,938,010 V314E possibly damaging Het
Uhrf1bp1 A G 17: 27,894,577 K1241R probably benign Het
Urb1 T C 16: 90,769,466 M1478V probably damaging Het
Ust C A 10: 8,298,190 V184F possibly damaging Het
Wdr95 G A 5: 149,588,098 C421Y probably damaging Het
Other mutations in Pde1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Pde1c APN 6 56173674 missense probably damaging 1.00
IGL02316:Pde1c APN 6 56151351 missense possibly damaging 0.77
IGL02751:Pde1c APN 6 56181688 missense probably damaging 1.00
IGL02801:Pde1c APN 6 56173666 missense probably damaging 1.00
IGL02975:Pde1c APN 6 56158936 missense probably damaging 1.00
IGL03357:Pde1c APN 6 56180093 missense probably damaging 1.00
R0523:Pde1c UTSW 6 56174941 missense probably damaging 1.00
R0717:Pde1c UTSW 6 56123012 missense probably damaging 0.98
R0973:Pde1c UTSW 6 56361815 missense probably benign 0.00
R1521:Pde1c UTSW 6 56173607 missense possibly damaging 0.91
R1818:Pde1c UTSW 6 56126892 nonsense probably null
R2004:Pde1c UTSW 6 56159011 missense probably damaging 1.00
R2026:Pde1c UTSW 6 56180190 missense probably damaging 1.00
R4380:Pde1c UTSW 6 56072278 missense probably null 0.02
R4729:Pde1c UTSW 6 56072209 missense probably damaging 1.00
R4847:Pde1c UTSW 6 56123034 missense possibly damaging 0.52
R4993:Pde1c UTSW 6 56150624 missense probably damaging 0.98
R5666:Pde1c UTSW 6 56126857 critical splice donor site probably null
R6005:Pde1c UTSW 6 56479202 splice site probably null
R6636:Pde1c UTSW 6 56180102 missense probably damaging 1.00
R6701:Pde1c UTSW 6 56181700 missense probably damaging 1.00
R6990:Pde1c UTSW 6 56442035 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGAAAAGCCGCCCTTTCTGCTG -3'
(R):5'- GTGACTGAAAGACTCACTGGGCTG -3'

Sequencing Primer
(F):5'- CTGCGTTAGAAGGTAGGAGCC -3'
(R):5'- GCTGGACCCAGCAAGGAG -3'
Posted On2014-05-23