Incidental Mutation 'R1344:Sf3b3'
ID200737
Institutional Source Beutler Lab
Gene Symbol Sf3b3
Ensembl Gene ENSMUSG00000033732
Gene Namesplicing factor 3b, subunit 3
Synonyms5730409A01Rik, 1810061H24Rik, D8Ertd633e, SAP130, RSE1
MMRRC Submission 039409-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.978) question?
Stock #R1344 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location110810239-110846787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 110838303 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 291 (A291G)
Ref Sequence ENSEMBL: ENSMUSP00000045073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042012]
Predicted Effect probably damaging
Transcript: ENSMUST00000042012
AA Change: A291G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045073
Gene: ENSMUSG00000033732
AA Change: A291G

DomainStartEndE-ValueType
Blast:SH3 17 70 5e-13 BLAST
Pfam:MMS1_N 76 592 3.2e-185 PFAM
low complexity region 716 728 N/A INTRINSIC
Pfam:CPSF_A 863 1184 4.3e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212613
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 3 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. Subunit 3 has also been identified as a component of the STAGA (SPT3-TAF(II)31-GCN5L acetylase) transcription coactivator-HAT (histone acetyltransferase) complex, and the TFTC (TATA-binding-protein-free TAF(II)-containing complex). These complexes may function in chromatin modification, transcription, splicing, and DNA repair. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik T G 6: 52,179,151 probably benign Het
Aco1 T C 4: 40,179,008 Y336H probably damaging Het
Adamts12 T A 15: 11,286,804 W832R probably damaging Het
Asxl2 A G 12: 3,493,790 K320E probably damaging Het
Atrnl1 G A 19: 57,935,705 probably null Het
B4galnt2 A C 11: 95,869,355 I282S probably benign Het
Bcl2l13 T C 6: 120,876,327 I191T probably benign Het
Cd101 A T 3: 101,018,775 Y209* probably null Het
Cd109 A T 9: 78,672,550 probably null Het
Cdc34 G A 10: 79,685,300 A128T probably damaging Het
Cdk12 T A 11: 98,241,785 S1013R unknown Het
Cntd1 T A 11: 101,285,740 L221Q possibly damaging Het
Cntn4 G A 6: 106,344,870 probably null Het
Col12a1 T A 9: 79,699,555 K529* probably null Het
Col17a1 T A 19: 47,671,505 D336V probably damaging Het
Creb3l4 A G 3: 90,238,738 I193T possibly damaging Het
Cyp2d10 A T 15: 82,405,905 probably null Het
Dcun1d3 A G 7: 119,857,935 F185L probably damaging Het
Dlec1 G A 9: 119,130,017 E910K probably benign Het
Dnajc19 T A 3: 34,058,012 N128I probably damaging Het
Dusp1 A G 17: 26,508,319 V2A probably benign Het
Eea1 G A 10: 95,994,999 probably null Het
Elf1 T C 14: 79,560,775 V34A probably damaging Het
Extl1 T C 4: 134,359,241 D501G probably damaging Het
Fam160b1 G A 19: 57,371,162 A45T possibly damaging Het
Fam198a A T 9: 121,978,386 H532L probably damaging Het
Fcgr2b T C 1: 170,961,081 Y319C probably damaging Het
Fxr2 A G 11: 69,648,884 H247R possibly damaging Het
Gfra1 A C 19: 58,238,417 S461A possibly damaging Het
Gli2 T G 1: 118,841,936 I629L probably damaging Het
Gm21671 T A 5: 25,953,109 T82S probably benign Het
Gm6614 A G 6: 141,985,618 S474P probably damaging Het
Gpx3 G A 11: 54,909,596 V207I probably damaging Het
Helz2 T C 2: 181,237,596 D743G possibly damaging Het
Hormad2 A G 11: 4,409,005 probably null Het
Ifitm1 C T 7: 140,968,350 T32M probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Lrit2 A G 14: 37,068,556 N64S probably benign Het
Lsm14a A T 7: 34,353,557 D322E probably damaging Het
Macf1 T G 4: 123,433,453 R4752S probably damaging Het
Mark3 T C 12: 111,627,837 I307T possibly damaging Het
Mpdz T A 4: 81,308,319 T1360S probably benign Het
Mtif2 G A 11: 29,545,002 V701I probably benign Het
Myh3 A G 11: 67,092,332 E895G probably benign Het
Ncan A C 8: 70,108,169 I716R probably benign Het
Ncor2 C T 5: 125,025,446 R1867K probably damaging Het
Oas1d C T 5: 120,914,896 L5F probably damaging Het
Olfr399 A T 11: 74,054,212 C182* probably null Het
Olfr45 T C 7: 140,691,799 V298A probably damaging Het
Olfr747 T A 14: 50,680,858 M259L probably benign Het
Olfr982 T A 9: 40,074,472 L59H probably damaging Het
Otog G T 7: 46,274,615 A1133S probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd11 A G 19: 47,130,077 D1794G probably damaging Het
Pde1c T C 6: 56,361,767 I27V probably benign Het
Pde4d C A 13: 109,950,387 S609* probably null Het
Piezo2 T A 18: 63,021,254 I2485F probably damaging Het
Plekhd1 A G 12: 80,692,885 T3A probably benign Het
Plscr1 C T 9: 92,259,304 T15I unknown Het
Rd3 T C 1: 191,985,301 *106R probably null Het
Rnf125 A G 18: 20,981,231 I97V possibly damaging Het
Sec24b T C 3: 130,007,423 N408S probably damaging Het
Simc1 T C 13: 54,550,479 V403A probably damaging Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Slitrk5 A G 14: 111,680,389 S482G probably benign Het
Smyd1 G A 6: 71,262,167 T13I probably benign Het
Stoml2 T A 4: 43,028,197 I344F probably benign Het
Tet1 C T 10: 62,814,521 R1636H probably damaging Het
Thap12 A G 7: 98,716,830 D735G probably damaging Het
Tnip3 T C 6: 65,597,429 V88A probably benign Het
Ttn A G 2: 76,735,411 V28199A possibly damaging Het
Ube3b T C 5: 114,418,575 F989S probably damaging Het
Ubox5 A G 2: 130,600,290 L159P probably damaging Het
Uevld A T 7: 46,938,010 V314E possibly damaging Het
Uhrf1bp1 A G 17: 27,894,577 K1241R probably benign Het
Urb1 T C 16: 90,769,466 M1478V probably damaging Het
Ust C A 10: 8,298,190 V184F possibly damaging Het
Wdr95 G A 5: 149,588,098 C421Y probably damaging Het
Other mutations in Sf3b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Sf3b3 APN 8 110813751 nonsense probably null
IGL00770:Sf3b3 APN 8 110817638 missense probably damaging 0.96
IGL00774:Sf3b3 APN 8 110817638 missense probably damaging 0.96
IGL01132:Sf3b3 APN 8 110842781 missense probably benign
IGL01487:Sf3b3 APN 8 110817660 missense probably benign 0.01
IGL02015:Sf3b3 APN 8 110816290 missense possibly damaging 0.82
IGL02126:Sf3b3 APN 8 110823443 missense probably benign
IGL02612:Sf3b3 APN 8 110842976 missense probably benign
IGL02833:Sf3b3 APN 8 110811977 critical splice donor site probably null
IGL03033:Sf3b3 APN 8 110810964 missense possibly damaging 0.62
IGL03366:Sf3b3 APN 8 110839954 missense probably damaging 1.00
R0458:Sf3b3 UTSW 8 110812136 splice site probably benign
R0907:Sf3b3 UTSW 8 110811510 splice site probably benign
R1468:Sf3b3 UTSW 8 110837374 missense probably damaging 1.00
R1468:Sf3b3 UTSW 8 110837374 missense probably damaging 1.00
R1736:Sf3b3 UTSW 8 110813832 missense probably benign
R1833:Sf3b3 UTSW 8 110817566 missense probably benign
R2225:Sf3b3 UTSW 8 110814573 missense probably damaging 1.00
R3236:Sf3b3 UTSW 8 110812020 missense probably damaging 0.99
R3615:Sf3b3 UTSW 8 110844523 missense probably damaging 1.00
R3616:Sf3b3 UTSW 8 110844523 missense probably damaging 1.00
R3683:Sf3b3 UTSW 8 110813621 critical splice donor site probably null
R4197:Sf3b3 UTSW 8 110821565 missense probably damaging 0.98
R4429:Sf3b3 UTSW 8 110826118 missense probably benign 0.01
R4674:Sf3b3 UTSW 8 110844505 missense probably damaging 0.99
R4895:Sf3b3 UTSW 8 110816024 missense probably benign 0.00
R4931:Sf3b3 UTSW 8 110816329 missense probably benign 0.00
R4948:Sf3b3 UTSW 8 110813669 missense probably damaging 0.99
R4999:Sf3b3 UTSW 8 110841203 missense probably benign 0.34
R5150:Sf3b3 UTSW 8 110823376 missense possibly damaging 0.88
R5175:Sf3b3 UTSW 8 110833835 missense probably benign
R5559:Sf3b3 UTSW 8 110838215 missense probably benign 0.00
R5866:Sf3b3 UTSW 8 110814634 missense probably benign
R5934:Sf3b3 UTSW 8 110823470 missense probably damaging 0.99
R6270:Sf3b3 UTSW 8 110841820 missense probably damaging 1.00
R6803:Sf3b3 UTSW 8 110825578 missense probably benign 0.01
X0024:Sf3b3 UTSW 8 110842932 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGAGAATCAGTCACACCTGCTCCC -3'
(R):5'- GTTAGTCCCTGAGTGCCCTGTGTA -3'

Sequencing Primer
(F):5'- cgcctctatctcagcactc -3'
(R):5'- AGTGCCCTGTGTAGCTCC -3'
Posted On2014-05-23