Incidental Mutation 'R1344:Mtif2'
ID200749
Institutional Source Beutler Lab
Gene Symbol Mtif2
Ensembl Gene ENSMUSG00000020459
Gene Namemitochondrial translational initiation factor 2
Synonyms2310038D14Rik, 2410112O06Rik, IF-2mt
MMRRC Submission 039409-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R1344 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location29526408-29545279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29545002 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 701 (V701I)
Ref Sequence ENSEMBL: ENSMUSP00000090926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020749] [ENSMUST00000020753] [ENSMUST00000093239] [ENSMUST00000102844] [ENSMUST00000102845] [ENSMUST00000144321] [ENSMUST00000208530]
Predicted Effect probably benign
Transcript: ENSMUST00000020749
AA Change: V701I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020749
Gene: ENSMUSG00000020459
AA Change: V701I

DomainStartEndE-ValueType
Pfam:SRPRB 178 310 2.1e-6 PFAM
Pfam:GTP_EFTU 179 344 8.9e-34 PFAM
Pfam:MMR_HSR1 182 289 6.9e-10 PFAM
coiled coil region 449 484 N/A INTRINSIC
Pfam:IF-2 504 607 6.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020753
SMART Domains Protein: ENSMUSP00000020753
Gene: ENSMUSG00000020461

DomainStartEndE-ValueType
Pfam:TSNAXIP1_N 28 152 2.6e-26 PFAM
Pfam:Clathrin_H_link 302 365 3.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093239
AA Change: V701I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090926
Gene: ENSMUSG00000020459
AA Change: V701I

DomainStartEndE-ValueType
Pfam:SRPRB 178 310 2.1e-6 PFAM
Pfam:GTP_EFTU 179 344 8.9e-34 PFAM
Pfam:MMR_HSR1 182 289 6.9e-10 PFAM
coiled coil region 449 484 N/A INTRINSIC
Pfam:IF-2 504 607 6.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102844
SMART Domains Protein: ENSMUSP00000099908
Gene: ENSMUSG00000020460

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_S27 101 147 9.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102845
SMART Domains Protein: ENSMUSP00000099909
Gene: ENSMUSG00000020460

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_S27 102 147 1.4e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129893
Predicted Effect probably benign
Transcript: ENSMUST00000132783
SMART Domains Protein: ENSMUSP00000121327
Gene: ENSMUSG00000020459

DomainStartEndE-ValueType
PDB:3IZY|P 47 247 8e-92 PDB
SCOP:d1g7sa1 163 244 2e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143418
Predicted Effect probably benign
Transcript: ENSMUST00000144321
SMART Domains Protein: ENSMUSP00000114299
Gene: ENSMUSG00000020459

DomainStartEndE-ValueType
Pfam:Arf 175 341 1.1e-5 PFAM
Pfam:SRPRB 178 310 1.5e-6 PFAM
Pfam:GTP_EFTU 178 344 3.8e-39 PFAM
Pfam:MMR_HSR1 182 289 1.1e-8 PFAM
Pfam:Miro 182 291 1.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150739
Predicted Effect probably benign
Transcript: ENSMUST00000208530
Meta Mutation Damage Score 0.166 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] During the initiation of protein biosynthesis, initiation factor-2 (IF-2) promotes the binding of the initiator tRNA to the small subunit of the ribosome in a GTP-dependent manner. Prokaryotic IF-2 is a single polypeptide, while eukaryotic cytoplasmic IF-2 (eIF-2) is a trimeric protein. Bovine liver mitochondria contain IF-2(mt), an 85-kD monomeric protein that is equivalent to prokaryotic IF-2. The predicted 727-amino acid human protein contains a 29-amino acid presequence. Human IF-2(mt) shares 32 to 38% amino acid sequence identity with yeast IF-2(mt) and several prokaryotic IF-2s, with the greatest degree of conservation in the G domains of the proteins. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik T G 6: 52,179,151 probably benign Het
Aco1 T C 4: 40,179,008 Y336H probably damaging Het
Adamts12 T A 15: 11,286,804 W832R probably damaging Het
Asxl2 A G 12: 3,493,790 K320E probably damaging Het
Atrnl1 G A 19: 57,935,705 probably null Het
B4galnt2 A C 11: 95,869,355 I282S probably benign Het
Bcl2l13 T C 6: 120,876,327 I191T probably benign Het
Cd101 A T 3: 101,018,775 Y209* probably null Het
Cd109 A T 9: 78,672,550 probably null Het
Cdc34 G A 10: 79,685,300 A128T probably damaging Het
Cdk12 T A 11: 98,241,785 S1013R unknown Het
Cntd1 T A 11: 101,285,740 L221Q possibly damaging Het
Cntn4 G A 6: 106,344,870 probably null Het
Col12a1 T A 9: 79,699,555 K529* probably null Het
Col17a1 T A 19: 47,671,505 D336V probably damaging Het
Creb3l4 A G 3: 90,238,738 I193T possibly damaging Het
Cyp2d10 A T 15: 82,405,905 probably null Het
Dcun1d3 A G 7: 119,857,935 F185L probably damaging Het
Dlec1 G A 9: 119,130,017 E910K probably benign Het
Dnajc19 T A 3: 34,058,012 N128I probably damaging Het
Dusp1 A G 17: 26,508,319 V2A probably benign Het
Eea1 G A 10: 95,994,999 probably null Het
Elf1 T C 14: 79,560,775 V34A probably damaging Het
Extl1 T C 4: 134,359,241 D501G probably damaging Het
Fam160b1 G A 19: 57,371,162 A45T possibly damaging Het
Fam198a A T 9: 121,978,386 H532L probably damaging Het
Fcgr2b T C 1: 170,961,081 Y319C probably damaging Het
Fxr2 A G 11: 69,648,884 H247R possibly damaging Het
Gfra1 A C 19: 58,238,417 S461A possibly damaging Het
Gli2 T G 1: 118,841,936 I629L probably damaging Het
Gm21671 T A 5: 25,953,109 T82S probably benign Het
Gm6614 A G 6: 141,985,618 S474P probably damaging Het
Gpx3 G A 11: 54,909,596 V207I probably damaging Het
Helz2 T C 2: 181,237,596 D743G possibly damaging Het
Hormad2 A G 11: 4,409,005 probably null Het
Ifitm1 C T 7: 140,968,350 T32M probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Lrit2 A G 14: 37,068,556 N64S probably benign Het
Lsm14a A T 7: 34,353,557 D322E probably damaging Het
Macf1 T G 4: 123,433,453 R4752S probably damaging Het
Mark3 T C 12: 111,627,837 I307T possibly damaging Het
Mpdz T A 4: 81,308,319 T1360S probably benign Het
Myh3 A G 11: 67,092,332 E895G probably benign Het
Ncan A C 8: 70,108,169 I716R probably benign Het
Ncor2 C T 5: 125,025,446 R1867K probably damaging Het
Oas1d C T 5: 120,914,896 L5F probably damaging Het
Olfr399 A T 11: 74,054,212 C182* probably null Het
Olfr45 T C 7: 140,691,799 V298A probably damaging Het
Olfr747 T A 14: 50,680,858 M259L probably benign Het
Olfr982 T A 9: 40,074,472 L59H probably damaging Het
Otog G T 7: 46,274,615 A1133S probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd11 A G 19: 47,130,077 D1794G probably damaging Het
Pde1c T C 6: 56,361,767 I27V probably benign Het
Pde4d C A 13: 109,950,387 S609* probably null Het
Piezo2 T A 18: 63,021,254 I2485F probably damaging Het
Plekhd1 A G 12: 80,692,885 T3A probably benign Het
Plscr1 C T 9: 92,259,304 T15I unknown Het
Rd3 T C 1: 191,985,301 *106R probably null Het
Rnf125 A G 18: 20,981,231 I97V possibly damaging Het
Sec24b T C 3: 130,007,423 N408S probably damaging Het
Sf3b3 G C 8: 110,838,303 A291G probably damaging Het
Simc1 T C 13: 54,550,479 V403A probably damaging Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Slitrk5 A G 14: 111,680,389 S482G probably benign Het
Smyd1 G A 6: 71,262,167 T13I probably benign Het
Stoml2 T A 4: 43,028,197 I344F probably benign Het
Tet1 C T 10: 62,814,521 R1636H probably damaging Het
Thap12 A G 7: 98,716,830 D735G probably damaging Het
Tnip3 T C 6: 65,597,429 V88A probably benign Het
Ttn A G 2: 76,735,411 V28199A possibly damaging Het
Ube3b T C 5: 114,418,575 F989S probably damaging Het
Ubox5 A G 2: 130,600,290 L159P probably damaging Het
Uevld A T 7: 46,938,010 V314E possibly damaging Het
Uhrf1bp1 A G 17: 27,894,577 K1241R probably benign Het
Urb1 T C 16: 90,769,466 M1478V probably damaging Het
Ust C A 10: 8,298,190 V184F possibly damaging Het
Wdr95 G A 5: 149,588,098 C421Y probably damaging Het
Other mutations in Mtif2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Mtif2 APN 11 29538753 missense probably damaging 1.00
IGL01020:Mtif2 APN 11 29544973 missense possibly damaging 0.61
IGL01323:Mtif2 APN 11 29541447 missense probably damaging 0.98
IGL01360:Mtif2 APN 11 29530110 missense probably benign 0.00
IGL01744:Mtif2 APN 11 29544417 unclassified probably benign
IGL01757:Mtif2 APN 11 29541337 unclassified probably benign
IGL02247:Mtif2 APN 11 29540642 missense possibly damaging 0.65
IGL02642:Mtif2 APN 11 29544395 missense probably benign
IGL03093:Mtif2 APN 11 29530702 splice site probably benign
R0418:Mtif2 UTSW 11 29533401 splice site probably benign
R0554:Mtif2 UTSW 11 29533398 critical splice donor site probably null
R0577:Mtif2 UTSW 11 29540862 critical splice donor site probably null
R1159:Mtif2 UTSW 11 29540729 missense possibly damaging 0.95
R1168:Mtif2 UTSW 11 29536914 missense probably benign 0.11
R1418:Mtif2 UTSW 11 29545002 missense probably benign
R1482:Mtif2 UTSW 11 29536847 missense probably damaging 1.00
R1657:Mtif2 UTSW 11 29540721 missense probably benign 0.00
R1850:Mtif2 UTSW 11 29540683 missense probably benign 0.03
R3692:Mtif2 UTSW 11 29540718 missense probably benign 0.03
R4471:Mtif2 UTSW 11 29540053 splice site probably benign
R4730:Mtif2 UTSW 11 29540834 missense probably benign 0.00
R5248:Mtif2 UTSW 11 29536889 missense probably damaging 1.00
R5343:Mtif2 UTSW 11 29536964 missense probably damaging 1.00
R5989:Mtif2 UTSW 11 29530098 missense probably damaging 0.96
R6511:Mtif2 UTSW 11 29536949 missense possibly damaging 0.81
X0064:Mtif2 UTSW 11 29538760 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AAGACATTTGCCTCATAAGCCCTACAG -3'
(R):5'- ACAAGCTAGGCATGGTGGTACATAGT -3'

Sequencing Primer
(F):5'- GGTAGTAACCAAATTGTCCTGACC -3'
(R):5'- agccatctctccagccc -3'
Posted On2014-05-23