Incidental Mutation 'R1344:Pde4d'
ID200761
Institutional Source Beutler Lab
Gene Symbol Pde4d
Ensembl Gene ENSMUSG00000021699
Gene Namephosphodiesterase 4D, cAMP specific
Synonymsdunce, Dpde3, 9630011N22Rik
MMRRC Submission 039409-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1344 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location108449948-109953461 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 109950387 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 609 (S609*)
Ref Sequence ENSEMBL: ENSMUSP00000136485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074103] [ENSMUST00000079975] [ENSMUST00000117420] [ENSMUST00000117879] [ENSMUST00000119507] [ENSMUST00000119672] [ENSMUST00000120664] [ENSMUST00000120671] [ENSMUST00000122041] [ENSMUST00000135275] [ENSMUST00000177907]
Predicted Effect probably null
Transcript: ENSMUST00000074103
AA Change: S540*
SMART Domains Protein: ENSMUSP00000073742
Gene: ENSMUSG00000021699
AA Change: S540*

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
HDc 329 504 1.12e-2 SMART
low complexity region 652 667 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000079975
AA Change: S560*
SMART Domains Protein: ENSMUSP00000078891
Gene: ENSMUSG00000021699
AA Change: S560*

DomainStartEndE-ValueType
HDc 349 524 1.12e-2 SMART
low complexity region 672 687 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117420
AA Change: S379*
SMART Domains Protein: ENSMUSP00000113610
Gene: ENSMUSG00000021699
AA Change: S379*

DomainStartEndE-ValueType
HDc 168 343 1.12e-2 SMART
low complexity region 491 506 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117879
AA Change: S366*
SMART Domains Protein: ENSMUSP00000112774
Gene: ENSMUSG00000021699
AA Change: S366*

DomainStartEndE-ValueType
HDc 155 330 1.12e-2 SMART
low complexity region 478 493 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119507
AA Change: S565*
SMART Domains Protein: ENSMUSP00000114089
Gene: ENSMUSG00000021699
AA Change: S565*

DomainStartEndE-ValueType
HDc 354 529 1.12e-2 SMART
low complexity region 677 692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119672
Predicted Effect probably null
Transcript: ENSMUST00000120664
AA Change: S446*
SMART Domains Protein: ENSMUSP00000113024
Gene: ENSMUSG00000021699
AA Change: S446*

DomainStartEndE-ValueType
HDc 235 410 1.12e-2 SMART
low complexity region 558 573 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120671
AA Change: S665*
SMART Domains Protein: ENSMUSP00000112991
Gene: ENSMUSG00000021699
AA Change: S665*

DomainStartEndE-ValueType
low complexity region 45 84 N/A INTRINSIC
HDc 454 629 1.12e-2 SMART
low complexity region 777 792 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000122041
AA Change: S609*
SMART Domains Protein: ENSMUSP00000113488
Gene: ENSMUSG00000021699
AA Change: S609*

DomainStartEndE-ValueType
HDc 398 573 1.12e-2 SMART
low complexity region 721 736 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135275
AA Change: S562*
SMART Domains Protein: ENSMUSP00000119583
Gene: ENSMUSG00000021699
AA Change: S562*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
HDc 351 526 1.12e-2 SMART
low complexity region 674 689 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000153234
AA Change: S615*
SMART Domains Protein: ENSMUSP00000121592
Gene: ENSMUSG00000021699
AA Change: S615*

DomainStartEndE-ValueType
PDB:1E9K|A 22 59 9e-18 PDB
low complexity region 69 85 N/A INTRINSIC
HDc 405 580 1.12e-2 SMART
low complexity region 728 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155459
SMART Domains Protein: ENSMUSP00000114945
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
Pfam:PDEase_I 121 189 2.6e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177907
AA Change: S609*
SMART Domains Protein: ENSMUSP00000136485
Gene: ENSMUSG00000021699
AA Change: S609*

DomainStartEndE-ValueType
HDc 398 573 1.12e-2 SMART
low complexity region 721 736 N/A INTRINSIC
Meta Mutation Damage Score 0.656 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit delayed growth, female infertility associated with impaired ovulation, and reduced postnatal viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik T G 6: 52,179,151 probably benign Het
Aco1 T C 4: 40,179,008 Y336H probably damaging Het
Adamts12 T A 15: 11,286,804 W832R probably damaging Het
Asxl2 A G 12: 3,493,790 K320E probably damaging Het
Atrnl1 G A 19: 57,935,705 probably null Het
B4galnt2 A C 11: 95,869,355 I282S probably benign Het
Bcl2l13 T C 6: 120,876,327 I191T probably benign Het
Cd101 A T 3: 101,018,775 Y209* probably null Het
Cd109 A T 9: 78,672,550 probably null Het
Cdc34 G A 10: 79,685,300 A128T probably damaging Het
Cdk12 T A 11: 98,241,785 S1013R unknown Het
Cntd1 T A 11: 101,285,740 L221Q possibly damaging Het
Cntn4 G A 6: 106,344,870 probably null Het
Col12a1 T A 9: 79,699,555 K529* probably null Het
Col17a1 T A 19: 47,671,505 D336V probably damaging Het
Creb3l4 A G 3: 90,238,738 I193T possibly damaging Het
Cyp2d10 A T 15: 82,405,905 probably null Het
Dcun1d3 A G 7: 119,857,935 F185L probably damaging Het
Dlec1 G A 9: 119,130,017 E910K probably benign Het
Dnajc19 T A 3: 34,058,012 N128I probably damaging Het
Dusp1 A G 17: 26,508,319 V2A probably benign Het
Eea1 G A 10: 95,994,999 probably null Het
Elf1 T C 14: 79,560,775 V34A probably damaging Het
Extl1 T C 4: 134,359,241 D501G probably damaging Het
Fam160b1 G A 19: 57,371,162 A45T possibly damaging Het
Fam198a A T 9: 121,978,386 H532L probably damaging Het
Fcgr2b T C 1: 170,961,081 Y319C probably damaging Het
Fxr2 A G 11: 69,648,884 H247R possibly damaging Het
Gfra1 A C 19: 58,238,417 S461A possibly damaging Het
Gli2 T G 1: 118,841,936 I629L probably damaging Het
Gm21671 T A 5: 25,953,109 T82S probably benign Het
Gm6614 A G 6: 141,985,618 S474P probably damaging Het
Gpx3 G A 11: 54,909,596 V207I probably damaging Het
Helz2 T C 2: 181,237,596 D743G possibly damaging Het
Hormad2 A G 11: 4,409,005 probably null Het
Ifitm1 C T 7: 140,968,350 T32M probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Lrit2 A G 14: 37,068,556 N64S probably benign Het
Lsm14a A T 7: 34,353,557 D322E probably damaging Het
Macf1 T G 4: 123,433,453 R4752S probably damaging Het
Mark3 T C 12: 111,627,837 I307T possibly damaging Het
Mpdz T A 4: 81,308,319 T1360S probably benign Het
Mtif2 G A 11: 29,545,002 V701I probably benign Het
Myh3 A G 11: 67,092,332 E895G probably benign Het
Ncan A C 8: 70,108,169 I716R probably benign Het
Ncor2 C T 5: 125,025,446 R1867K probably damaging Het
Oas1d C T 5: 120,914,896 L5F probably damaging Het
Olfr399 A T 11: 74,054,212 C182* probably null Het
Olfr45 T C 7: 140,691,799 V298A probably damaging Het
Olfr747 T A 14: 50,680,858 M259L probably benign Het
Olfr982 T A 9: 40,074,472 L59H probably damaging Het
Otog G T 7: 46,274,615 A1133S probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd11 A G 19: 47,130,077 D1794G probably damaging Het
Pde1c T C 6: 56,361,767 I27V probably benign Het
Piezo2 T A 18: 63,021,254 I2485F probably damaging Het
Plekhd1 A G 12: 80,692,885 T3A probably benign Het
Plscr1 C T 9: 92,259,304 T15I unknown Het
Rd3 T C 1: 191,985,301 *106R probably null Het
Rnf125 A G 18: 20,981,231 I97V possibly damaging Het
Sec24b T C 3: 130,007,423 N408S probably damaging Het
Sf3b3 G C 8: 110,838,303 A291G probably damaging Het
Simc1 T C 13: 54,550,479 V403A probably damaging Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Slitrk5 A G 14: 111,680,389 S482G probably benign Het
Smyd1 G A 6: 71,262,167 T13I probably benign Het
Stoml2 T A 4: 43,028,197 I344F probably benign Het
Tet1 C T 10: 62,814,521 R1636H probably damaging Het
Thap12 A G 7: 98,716,830 D735G probably damaging Het
Tnip3 T C 6: 65,597,429 V88A probably benign Het
Ttn A G 2: 76,735,411 V28199A possibly damaging Het
Ube3b T C 5: 114,418,575 F989S probably damaging Het
Ubox5 A G 2: 130,600,290 L159P probably damaging Het
Uevld A T 7: 46,938,010 V314E possibly damaging Het
Uhrf1bp1 A G 17: 27,894,577 K1241R probably benign Het
Urb1 T C 16: 90,769,466 M1478V probably damaging Het
Ust C A 10: 8,298,190 V184F possibly damaging Het
Wdr95 G A 5: 149,588,098 C421Y probably damaging Het
Other mutations in Pde4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Pde4d APN 13 109936687 missense possibly damaging 0.69
IGL00792:Pde4d APN 13 109935395 missense possibly damaging 0.85
IGL01014:Pde4d APN 13 109949502 missense probably damaging 1.00
IGL01660:Pde4d APN 13 109938072 missense probably damaging 1.00
IGL02233:Pde4d APN 13 109740550 missense probably damaging 1.00
IGL02405:Pde4d APN 13 108860209 critical splice donor site probably null
IGL02544:Pde4d APN 13 109740523 missense probably damaging 1.00
IGL02885:Pde4d APN 13 109948261 missense probably damaging 1.00
IGL03286:Pde4d APN 13 109954506 unclassified probably benign
IGL03406:Pde4d APN 13 109954591 unclassified probably benign
Heliosphere UTSW 13 109116942 missense probably benign
Stubbs UTSW 13 109772722 intron probably benign
IGL03055:Pde4d UTSW 13 109935345 missense probably damaging 1.00
R0020:Pde4d UTSW 13 109954570 missense possibly damaging 0.66
R0020:Pde4d UTSW 13 109954570 missense possibly damaging 0.66
R0054:Pde4d UTSW 13 109740421 missense probably benign 0.23
R0054:Pde4d UTSW 13 109740421 missense probably benign 0.23
R0357:Pde4d UTSW 13 109951268 missense possibly damaging 0.46
R0482:Pde4d UTSW 13 109936710 missense probably benign 0.00
R0689:Pde4d UTSW 13 109740544 missense possibly damaging 0.78
R0884:Pde4d UTSW 13 109950940 missense probably damaging 0.99
R1169:Pde4d UTSW 13 109950928 splice site probably null
R1225:Pde4d UTSW 13 109950221 missense probably benign 0.04
R1246:Pde4d UTSW 13 109950973 missense probably damaging 1.00
R1351:Pde4d UTSW 13 109951275 missense possibly damaging 0.46
R1371:Pde4d UTSW 13 109117061 missense probably benign 0.00
R1418:Pde4d UTSW 13 109950387 nonsense probably null
R2197:Pde4d UTSW 13 109948390 missense probably damaging 1.00
R2440:Pde4d UTSW 13 109927197 intron probably benign
R3114:Pde4d UTSW 13 109948258 missense probably damaging 1.00
R3115:Pde4d UTSW 13 109948258 missense probably damaging 1.00
R3722:Pde4d UTSW 13 109951332 nonsense probably null
R3742:Pde4d UTSW 13 109740479 missense probably benign 0.42
R3797:Pde4d UTSW 13 109632897 missense probably benign 0.29
R3983:Pde4d UTSW 13 109740406 missense probably benign 0.23
R4618:Pde4d UTSW 13 109933877 missense probably benign 0.13
R4768:Pde4d UTSW 13 109933874 missense probably damaging 1.00
R4795:Pde4d UTSW 13 109938171 intron probably benign
R4824:Pde4d UTSW 13 109116866 missense probably benign 0.00
R4942:Pde4d UTSW 13 108860199 missense probably benign 0.00
R4984:Pde4d UTSW 13 109740464 missense probably damaging 1.00
R5180:Pde4d UTSW 13 109740473 missense probably benign 0.13
R5267:Pde4d UTSW 13 109260809 intron probably benign
R5311:Pde4d UTSW 13 109632864 missense probably benign 0.02
R5311:Pde4d UTSW 13 109632865 missense probably benign
R5376:Pde4d UTSW 13 109772644 missense probably benign 0.00
R5551:Pde4d UTSW 13 109948396 critical splice donor site probably null
R5753:Pde4d UTSW 13 109772722 intron probably benign
R5754:Pde4d UTSW 13 109938013 missense probably damaging 0.98
R5838:Pde4d UTSW 13 109740442 missense probably damaging 0.99
R5864:Pde4d UTSW 13 109938048 missense probably benign 0.00
R6039:Pde4d UTSW 13 109948342 missense probably damaging 1.00
R6039:Pde4d UTSW 13 109948342 missense probably damaging 1.00
R6049:Pde4d UTSW 13 109032585 nonsense probably null
R6214:Pde4d UTSW 13 109949433 missense probably damaging 1.00
R6215:Pde4d UTSW 13 109949433 missense probably damaging 1.00
R6273:Pde4d UTSW 13 109950221 missense possibly damaging 0.94
R6431:Pde4d UTSW 13 109601786 unclassified probably null
R6501:Pde4d UTSW 13 109116942 missense probably benign
R6534:Pde4d UTSW 13 109632901 missense probably benign 0.05
R6709:Pde4d UTSW 13 109948279 missense probably damaging 1.00
R6722:Pde4d UTSW 13 109632898 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCGAATAAGAAATGCCTCCATCC -3'
(R):5'- GGTCAGTTTGAGCCAACAGATCACG -3'

Sequencing Primer
(F):5'- CCCAGGTCCTTCAGAATATGGTG -3'
(R):5'- CAGTGAGAGACTCTTGTACCATACG -3'
Posted On2014-05-23