Incidental Mutation 'R1344:Olfr747'
ID200764
Institutional Source Beutler Lab
Gene Symbol Olfr747
Ensembl Gene ENSMUSG00000057179
Gene Nameolfactory receptor 747
SynonymsGA_x6K02T2PMLR-6420220-6419279, MOR106-7, MOR106-16
MMRRC Submission 039409-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1344 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location50680657-50693206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50680858 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 259 (M259L)
Ref Sequence ENSEMBL: ENSMUSP00000149081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078075] [ENSMUST00000205373] [ENSMUST00000205897] [ENSMUST00000213238]
Predicted Effect probably benign
Transcript: ENSMUST00000078075
AA Change: M259L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077220
Gene: ENSMUSG00000057179
AA Change: M259L

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 2.2e-53 PFAM
Pfam:7tm_1 40 289 2.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205373
AA Change: M259L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000205897
Predicted Effect probably benign
Transcript: ENSMUST00000213238
AA Change: M259L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik T G 6: 52,179,151 probably benign Het
Aco1 T C 4: 40,179,008 Y336H probably damaging Het
Adamts12 T A 15: 11,286,804 W832R probably damaging Het
Asxl2 A G 12: 3,493,790 K320E probably damaging Het
Atrnl1 G A 19: 57,935,705 probably null Het
B4galnt2 A C 11: 95,869,355 I282S probably benign Het
Bcl2l13 T C 6: 120,876,327 I191T probably benign Het
Cd101 A T 3: 101,018,775 Y209* probably null Het
Cd109 A T 9: 78,672,550 probably null Het
Cdc34 G A 10: 79,685,300 A128T probably damaging Het
Cdk12 T A 11: 98,241,785 S1013R unknown Het
Cntd1 T A 11: 101,285,740 L221Q possibly damaging Het
Cntn4 G A 6: 106,344,870 probably null Het
Col12a1 T A 9: 79,699,555 K529* probably null Het
Col17a1 T A 19: 47,671,505 D336V probably damaging Het
Creb3l4 A G 3: 90,238,738 I193T possibly damaging Het
Cyp2d10 A T 15: 82,405,905 probably null Het
Dcun1d3 A G 7: 119,857,935 F185L probably damaging Het
Dlec1 G A 9: 119,130,017 E910K probably benign Het
Dnajc19 T A 3: 34,058,012 N128I probably damaging Het
Dusp1 A G 17: 26,508,319 V2A probably benign Het
Eea1 G A 10: 95,994,999 probably null Het
Elf1 T C 14: 79,560,775 V34A probably damaging Het
Extl1 T C 4: 134,359,241 D501G probably damaging Het
Fam160b1 G A 19: 57,371,162 A45T possibly damaging Het
Fam198a A T 9: 121,978,386 H532L probably damaging Het
Fcgr2b T C 1: 170,961,081 Y319C probably damaging Het
Fxr2 A G 11: 69,648,884 H247R possibly damaging Het
Gfra1 A C 19: 58,238,417 S461A possibly damaging Het
Gli2 T G 1: 118,841,936 I629L probably damaging Het
Gm21671 T A 5: 25,953,109 T82S probably benign Het
Gm6614 A G 6: 141,985,618 S474P probably damaging Het
Gpx3 G A 11: 54,909,596 V207I probably damaging Het
Helz2 T C 2: 181,237,596 D743G possibly damaging Het
Hormad2 A G 11: 4,409,005 probably null Het
Ifitm1 C T 7: 140,968,350 T32M probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Lrit2 A G 14: 37,068,556 N64S probably benign Het
Lsm14a A T 7: 34,353,557 D322E probably damaging Het
Macf1 T G 4: 123,433,453 R4752S probably damaging Het
Mark3 T C 12: 111,627,837 I307T possibly damaging Het
Mpdz T A 4: 81,308,319 T1360S probably benign Het
Mtif2 G A 11: 29,545,002 V701I probably benign Het
Myh3 A G 11: 67,092,332 E895G probably benign Het
Ncan A C 8: 70,108,169 I716R probably benign Het
Ncor2 C T 5: 125,025,446 R1867K probably damaging Het
Oas1d C T 5: 120,914,896 L5F probably damaging Het
Olfr399 A T 11: 74,054,212 C182* probably null Het
Olfr45 T C 7: 140,691,799 V298A probably damaging Het
Olfr982 T A 9: 40,074,472 L59H probably damaging Het
Otog G T 7: 46,274,615 A1133S probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd11 A G 19: 47,130,077 D1794G probably damaging Het
Pde1c T C 6: 56,361,767 I27V probably benign Het
Pde4d C A 13: 109,950,387 S609* probably null Het
Piezo2 T A 18: 63,021,254 I2485F probably damaging Het
Plekhd1 A G 12: 80,692,885 T3A probably benign Het
Plscr1 C T 9: 92,259,304 T15I unknown Het
Rd3 T C 1: 191,985,301 *106R probably null Het
Rnf125 A G 18: 20,981,231 I97V possibly damaging Het
Sec24b T C 3: 130,007,423 N408S probably damaging Het
Sf3b3 G C 8: 110,838,303 A291G probably damaging Het
Simc1 T C 13: 54,550,479 V403A probably damaging Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Slitrk5 A G 14: 111,680,389 S482G probably benign Het
Smyd1 G A 6: 71,262,167 T13I probably benign Het
Stoml2 T A 4: 43,028,197 I344F probably benign Het
Tet1 C T 10: 62,814,521 R1636H probably damaging Het
Thap12 A G 7: 98,716,830 D735G probably damaging Het
Tnip3 T C 6: 65,597,429 V88A probably benign Het
Ttn A G 2: 76,735,411 V28199A possibly damaging Het
Ube3b T C 5: 114,418,575 F989S probably damaging Het
Ubox5 A G 2: 130,600,290 L159P probably damaging Het
Uevld A T 7: 46,938,010 V314E possibly damaging Het
Uhrf1bp1 A G 17: 27,894,577 K1241R probably benign Het
Urb1 T C 16: 90,769,466 M1478V probably damaging Het
Ust C A 10: 8,298,190 V184F possibly damaging Het
Wdr95 G A 5: 149,588,098 C421Y probably damaging Het
Other mutations in Olfr747
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02437:Olfr747 APN 14 50681200 missense probably benign 0.04
R0349:Olfr747 UTSW 14 50681254 missense probably benign 0.00
R0613:Olfr747 UTSW 14 50681404 missense probably benign 0.06
R1023:Olfr747 UTSW 14 50681016 missense probably damaging 1.00
R1126:Olfr747 UTSW 14 50681263 missense possibly damaging 0.94
R1298:Olfr747 UTSW 14 50680880 nonsense probably null
R1775:Olfr747 UTSW 14 50681166 missense possibly damaging 0.66
R1928:Olfr747 UTSW 14 50681415 missense probably benign 0.00
R2208:Olfr747 UTSW 14 50681563 missense probably benign 0.01
R4181:Olfr747 UTSW 14 50681050 missense probably benign 0.07
R4183:Olfr747 UTSW 14 50681050 missense probably benign 0.07
R4184:Olfr747 UTSW 14 50681050 missense probably benign 0.07
R5104:Olfr747 UTSW 14 50680702 nonsense probably null
R6144:Olfr747 UTSW 14 50680935 missense probably benign 0.01
R6768:Olfr747 UTSW 14 50681592 missense probably damaging 1.00
X0067:Olfr747 UTSW 14 50681529 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CATGAGTACCTGAGTAGACCATCTCACA -3'
(R):5'- GCCGCCCATTACATTACCCTACTATC -3'

Sequencing Primer
(F):5'- aatatggaggtaggggaatcaag -3'
(R):5'- CCTACTATCATGACTAGGAGGCTG -3'
Posted On2014-05-23