Incidental Mutation 'R0089:Grb10'
ID20078
Institutional Source Beutler Lab
Gene Symbol Grb10
Ensembl Gene ENSMUSG00000020176
Gene Namegrowth factor receptor bound protein 10
Synonyms5730571D09Rik, maternally expressed gene 1, Meg1
MMRRC Submission 038376-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R0089 (G1)
Quality Score165
Status Validated
Chromosome11
Chromosomal Location11930508-12038683 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 11934192 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093321] [ENSMUST00000109653] [ENSMUST00000109654]
Predicted Effect probably benign
Transcript: ENSMUST00000093321
SMART Domains Protein: ENSMUSP00000091011
Gene: ENSMUSG00000020176

DomainStartEndE-ValueType
low complexity region 92 119 N/A INTRINSIC
RA 169 253 2.56e-20 SMART
PH 294 404 7.13e-10 SMART
Pfam:BPS 427 473 6.4e-31 PFAM
SH2 493 582 7.78e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109653
SMART Domains Protein: ENSMUSP00000105280
Gene: ENSMUSG00000020176

DomainStartEndE-ValueType
low complexity region 92 119 N/A INTRINSIC
RA 169 253 2.56e-20 SMART
Blast:PH 285 358 1e-44 BLAST
Pfam:BPS 381 428 3.5e-33 PFAM
SH2 447 536 7.78e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109654
SMART Domains Protein: ENSMUSP00000105281
Gene: ENSMUSG00000020176

DomainStartEndE-ValueType
RA 114 198 5.45e-24 SMART
PH 239 349 7.13e-10 SMART
Pfam:BPS 372 419 5.4e-33 PFAM
SH2 438 527 7.78e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124587
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to a small family of adapter proteins that are known to interact with a number of receptor tyrosine kinases and signaling molecules. This gene encodes a growth factor receptor-binding protein that interacts with insulin receptors and insulin-like growth-factor receptors. Overexpression of some isoforms of the encoded protein inhibits tyrosine kinase activity and results in growth suppression. This gene is imprinted in a highly isoform- and tissue-specific manner, with expression observed from the paternal allele in the brain, and from the maternal allele in the placental trophoblasts. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2010]
PHENOTYPE: Maternal transmission of a mutant allele results in both fetal and placental overgrowth. Disproportionate overgrowth of the liver is observed. Paternal transmission of an allele lacking the differentially methylated region results in growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,292,886 V1583E possibly damaging Het
Ablim1 G T 19: 57,043,031 S654Y probably damaging Het
Acbd4 T C 11: 103,103,993 F59S probably damaging Het
Acot1 T C 12: 84,016,934 I272T probably damaging Het
Ankhd1 A G 18: 36,640,356 D1402G probably damaging Het
Birc6 T A 17: 74,638,376 F2800I possibly damaging Het
Brd1 T C 15: 88,701,198 E811G probably benign Het
Ccdc106 A G 7: 5,056,221 probably null Het
Ccdc81 G T 7: 89,893,116 A184E possibly damaging Het
Cenpt T C 8: 105,846,368 T364A probably benign Het
Crybg2 T C 4: 134,081,194 S1060P probably damaging Het
Dnttip2 A G 3: 122,275,462 T109A possibly damaging Het
Dpy19l2 A G 9: 24,695,793 L124P probably benign Het
Fat3 T C 9: 15,938,205 D3967G probably benign Het
Fbxo21 T A 5: 118,008,143 F610L probably benign Het
Fmo9 T C 1: 166,667,309 D341G probably benign Het
Frem3 A T 8: 80,615,878 H1600L possibly damaging Het
Fry A T 5: 150,340,427 K133N possibly damaging Het
Gm10647 A G 9: 66,798,330 probably benign Het
Gm13124 T A 4: 144,555,733 H163L probably benign Het
Gm16432 C T 1: 178,046,989 P141S unknown Het
Gm21319 A T 12: 87,773,513 I92N probably damaging Het
Gmps T C 3: 63,998,698 F472S probably benign Het
Grm6 G A 11: 50,859,965 G652S probably damaging Het
Heca G T 10: 17,908,100 D468E probably damaging Het
Heg1 C T 16: 33,763,615 S1033L probably damaging Het
Hepacam2 A G 6: 3,487,094 S12P probably damaging Het
Impdh1 G T 6: 29,206,326 H195N probably benign Het
Ipo7 T C 7: 110,050,765 probably benign Het
Itpr2 C T 6: 146,350,022 probably null Het
Kcnh6 G A 11: 106,009,022 C39Y probably benign Het
Kif26a T C 12: 112,177,403 S1364P probably damaging Het
Lins1 T A 7: 66,712,048 probably benign Het
Lrpap1 C T 5: 35,094,888 V328M possibly damaging Het
Lyn T G 4: 3,748,768 L249V probably benign Het
Mpp7 A G 18: 7,439,555 probably benign Het
Mtmr9 A G 14: 63,528,247 F400L possibly damaging Het
Mto1 G A 9: 78,473,872 S666N probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nsg1 T C 5: 38,155,630 E75G probably benign Het
Nsun4 A G 4: 116,035,773 M283T probably benign Het
Obscn A G 11: 59,000,062 S7215P unknown Het
Olfr1042 A C 2: 86,159,574 S265R possibly damaging Het
Olfr1160 T C 2: 88,005,987 I264V probably damaging Het
Olfr1383 G A 11: 49,524,206 S161N possibly damaging Het
Olfr340 G A 2: 36,453,095 R170K probably benign Het
Olfr53 T C 7: 140,652,311 S111P probably damaging Het
Olfr677 T A 7: 105,057,090 Y281* probably null Het
Olfr736 T C 14: 50,392,864 I36T probably benign Het
Per1 T C 11: 69,104,043 F563S probably benign Het
Pik3c3 T A 18: 30,303,078 probably benign Het
Pitrm1 A T 13: 6,555,639 K207N probably damaging Het
Prdm10 C T 9: 31,316,230 R44C probably damaging Het
Rab40c A T 17: 25,885,148 I90N probably damaging Het
Rbl1 A G 2: 157,199,414 probably null Het
Rnf17 G A 14: 56,514,106 G1467E probably damaging Het
Rpgrip1 A G 14: 52,149,384 probably benign Het
Sall1 A T 8: 89,030,268 N1069K probably benign Het
Scap T C 9: 110,372,222 I93T possibly damaging Het
Sez6 T C 11: 77,974,344 probably benign Het
Slc22a30 A T 19: 8,370,197 S280T probably benign Het
Slc26a5 A C 5: 21,811,344 probably null Het
St18 T C 1: 6,848,948 V901A probably benign Het
Syne2 T C 12: 75,963,876 L2519P probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tmem51 T C 4: 142,031,925 T171A probably benign Het
Tns4 A T 11: 99,075,198 I453N probably damaging Het
Trank1 A T 9: 111,392,910 H2905L probably benign Het
Trim13 C T 14: 61,604,717 T61I possibly damaging Het
Trim75 T C 8: 64,982,928 Q290R possibly damaging Het
Ttn C A 2: 76,729,200 R29619L probably damaging Het
Ugt2b38 T A 5: 87,420,558 M293L probably benign Het
Vmn1r22 T A 6: 57,900,528 N155Y probably benign Het
Vmn2r18 T C 5: 151,584,804 Y285C probably benign Het
Vmn2r84 C T 10: 130,386,719 probably benign Het
Vwde A C 6: 13,220,005 L49R probably damaging Het
Yipf2 T A 9: 21,591,966 E68D possibly damaging Het
Zfand5 C A 19: 21,279,758 probably benign Het
Other mutations in Grb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Grb10 APN 11 11945599 missense probably damaging 1.00
IGL01450:Grb10 APN 11 11970432 missense probably damaging 1.00
IGL01872:Grb10 APN 11 11970547 missense probably damaging 0.99
IGL02164:Grb10 APN 11 11943962 missense probably damaging 1.00
IGL02508:Grb10 APN 11 11946767 missense probably damaging 1.00
IGL02626:Grb10 APN 11 11945503 missense probably benign 0.00
IGL03275:Grb10 APN 11 11933591 missense possibly damaging 0.46
R0042:Grb10 UTSW 11 11936798 missense probably damaging 1.00
R0042:Grb10 UTSW 11 11936798 missense probably damaging 1.00
R0196:Grb10 UTSW 11 11945583 missense probably damaging 1.00
R0419:Grb10 UTSW 11 11934207 missense possibly damaging 0.87
R0645:Grb10 UTSW 11 11936755 missense probably damaging 0.98
R1473:Grb10 UTSW 11 11934249 missense probably damaging 1.00
R1848:Grb10 UTSW 11 11946029 missense possibly damaging 0.78
R2025:Grb10 UTSW 11 11970576 nonsense probably null
R4455:Grb10 UTSW 11 11967665 missense possibly damaging 0.93
R4857:Grb10 UTSW 11 11951469 unclassified probably benign
R5289:Grb10 UTSW 11 11944924 splice site silent
R5522:Grb10 UTSW 11 11936746 missense probably benign 0.05
R5696:Grb10 UTSW 11 11933566 missense probably benign 0.23
R6119:Grb10 UTSW 11 11933551 missense probably damaging 1.00
R6163:Grb10 UTSW 11 11943932 nonsense probably null
R6267:Grb10 UTSW 11 11970639 start gained probably benign
R6328:Grb10 UTSW 11 11937905 missense probably damaging 1.00
R6741:Grb10 UTSW 11 11936717 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTCAGCAACATTCCCTCTTGGAGTC -3'
(R):5'- GGTACTAGCACTCATGTGCCAGAAC -3'

Sequencing Primer
(F):5'- AACATTCCCTCTTGGAGTCTCTTG -3'
(R):5'- GTACACATGCATACATGGATGCTC -3'
Posted On2013-04-11