Incidental Mutation 'R1344:Gfra1'
ID200785
Institutional Source Beutler Lab
Gene Symbol Gfra1
Ensembl Gene ENSMUSG00000025089
Gene Nameglial cell line derived neurotrophic factor family receptor alpha 1
SynonymsGDNFR-alpha, GFR alpha-1
MMRRC Submission 039409-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1344 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location58235604-58455909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 58238417 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 461 (S461A)
Ref Sequence ENSEMBL: ENSMUSP00000130128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026076] [ENSMUST00000129100] [ENSMUST00000140141] [ENSMUST00000152507] [ENSMUST00000169850]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026076
AA Change: S461A

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000026076
Gene: ENSMUSG00000025089
AA Change: S461A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000129100
AA Change: S456A

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117196
Gene: ENSMUSG00000025089
AA Change: S456A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 149 228 6.55e-24 SMART
GDNF 238 332 1.62e-28 SMART
low complexity region 357 365 N/A INTRINSIC
low complexity region 450 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140141
SMART Domains Protein: ENSMUSP00000123022
Gene: ENSMUSG00000025089

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143595
Predicted Effect possibly damaging
Transcript: ENSMUST00000152507
AA Change: S461A

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120333
Gene: ENSMUSG00000025089
AA Change: S461A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169850
AA Change: S461A

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130128
Gene: ENSMUSG00000025089
AA Change: S461A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that functions as the receptor for glial cell line derived neurotrophic factor (GDNF). The encoded protein undergoes proteolytic processing to generate a glycosylphosphatidylinositol-anchored cell surface coreceptor that forms a complex with the Ret tyrosine kinase in GDNF signaling pathway. Mice lacking the encoded protein exhibit deficits in the kidneys, the enteric nervous system, and spinal motor and sensory neurons similar mice deficient in GDNF or Ret. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations lack kidneys and enteric neurons resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik T G 6: 52,179,151 probably benign Het
Aco1 T C 4: 40,179,008 Y336H probably damaging Het
Adamts12 T A 15: 11,286,804 W832R probably damaging Het
Asxl2 A G 12: 3,493,790 K320E probably damaging Het
Atrnl1 G A 19: 57,935,705 probably null Het
B4galnt2 A C 11: 95,869,355 I282S probably benign Het
Bcl2l13 T C 6: 120,876,327 I191T probably benign Het
Cd101 A T 3: 101,018,775 Y209* probably null Het
Cd109 A T 9: 78,672,550 probably null Het
Cdc34 G A 10: 79,685,300 A128T probably damaging Het
Cdk12 T A 11: 98,241,785 S1013R unknown Het
Cntd1 T A 11: 101,285,740 L221Q possibly damaging Het
Cntn4 G A 6: 106,344,870 probably null Het
Col12a1 T A 9: 79,699,555 K529* probably null Het
Col17a1 T A 19: 47,671,505 D336V probably damaging Het
Creb3l4 A G 3: 90,238,738 I193T possibly damaging Het
Cyp2d10 A T 15: 82,405,905 probably null Het
Dcun1d3 A G 7: 119,857,935 F185L probably damaging Het
Dlec1 G A 9: 119,130,017 E910K probably benign Het
Dnajc19 T A 3: 34,058,012 N128I probably damaging Het
Dusp1 A G 17: 26,508,319 V2A probably benign Het
Eea1 G A 10: 95,994,999 probably null Het
Elf1 T C 14: 79,560,775 V34A probably damaging Het
Extl1 T C 4: 134,359,241 D501G probably damaging Het
Fam160b1 G A 19: 57,371,162 A45T possibly damaging Het
Fam198a A T 9: 121,978,386 H532L probably damaging Het
Fcgr2b T C 1: 170,961,081 Y319C probably damaging Het
Fxr2 A G 11: 69,648,884 H247R possibly damaging Het
Gli2 T G 1: 118,841,936 I629L probably damaging Het
Gm21671 T A 5: 25,953,109 T82S probably benign Het
Gm6614 A G 6: 141,985,618 S474P probably damaging Het
Gpx3 G A 11: 54,909,596 V207I probably damaging Het
Helz2 T C 2: 181,237,596 D743G possibly damaging Het
Hormad2 A G 11: 4,409,005 probably null Het
Ifitm1 C T 7: 140,968,350 T32M probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Lrit2 A G 14: 37,068,556 N64S probably benign Het
Lsm14a A T 7: 34,353,557 D322E probably damaging Het
Macf1 T G 4: 123,433,453 R4752S probably damaging Het
Mark3 T C 12: 111,627,837 I307T possibly damaging Het
Mpdz T A 4: 81,308,319 T1360S probably benign Het
Mtif2 G A 11: 29,545,002 V701I probably benign Het
Myh3 A G 11: 67,092,332 E895G probably benign Het
Ncan A C 8: 70,108,169 I716R probably benign Het
Ncor2 C T 5: 125,025,446 R1867K probably damaging Het
Oas1d C T 5: 120,914,896 L5F probably damaging Het
Olfr399 A T 11: 74,054,212 C182* probably null Het
Olfr45 T C 7: 140,691,799 V298A probably damaging Het
Olfr747 T A 14: 50,680,858 M259L probably benign Het
Olfr982 T A 9: 40,074,472 L59H probably damaging Het
Otog G T 7: 46,274,615 A1133S probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd11 A G 19: 47,130,077 D1794G probably damaging Het
Pde1c T C 6: 56,361,767 I27V probably benign Het
Pde4d C A 13: 109,950,387 S609* probably null Het
Piezo2 T A 18: 63,021,254 I2485F probably damaging Het
Plekhd1 A G 12: 80,692,885 T3A probably benign Het
Plscr1 C T 9: 92,259,304 T15I unknown Het
Rd3 T C 1: 191,985,301 *106R probably null Het
Rnf125 A G 18: 20,981,231 I97V possibly damaging Het
Sec24b T C 3: 130,007,423 N408S probably damaging Het
Sf3b3 G C 8: 110,838,303 A291G probably damaging Het
Simc1 T C 13: 54,550,479 V403A probably damaging Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Slitrk5 A G 14: 111,680,389 S482G probably benign Het
Smyd1 G A 6: 71,262,167 T13I probably benign Het
Stoml2 T A 4: 43,028,197 I344F probably benign Het
Tet1 C T 10: 62,814,521 R1636H probably damaging Het
Thap12 A G 7: 98,716,830 D735G probably damaging Het
Tnip3 T C 6: 65,597,429 V88A probably benign Het
Ttn A G 2: 76,735,411 V28199A possibly damaging Het
Ube3b T C 5: 114,418,575 F989S probably damaging Het
Ubox5 A G 2: 130,600,290 L159P probably damaging Het
Uevld A T 7: 46,938,010 V314E possibly damaging Het
Uhrf1bp1 A G 17: 27,894,577 K1241R probably benign Het
Urb1 T C 16: 90,769,466 M1478V probably damaging Het
Ust C A 10: 8,298,190 V184F possibly damaging Het
Wdr95 G A 5: 149,588,098 C421Y probably damaging Het
Other mutations in Gfra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Gfra1 APN 19 58263905 splice site probably benign
IGL01633:Gfra1 APN 19 58267047 missense probably benign 0.41
IGL02675:Gfra1 APN 19 58453355 missense probably damaging 1.00
IGL02676:Gfra1 APN 19 58453355 missense probably damaging 1.00
IGL02677:Gfra1 APN 19 58453355 missense probably damaging 1.00
IGL02723:Gfra1 APN 19 58453251 missense probably benign 0.00
3-1:Gfra1 UTSW 19 58298567 intron probably benign
R0245:Gfra1 UTSW 19 58300554 missense possibly damaging 0.72
R0652:Gfra1 UTSW 19 58300554 missense possibly damaging 0.72
R0697:Gfra1 UTSW 19 58270123 missense probably benign
R0699:Gfra1 UTSW 19 58270123 missense probably benign
R1418:Gfra1 UTSW 19 58238417 missense possibly damaging 0.88
R1468:Gfra1 UTSW 19 58451975 missense probably benign 0.00
R1468:Gfra1 UTSW 19 58451975 missense probably benign 0.00
R2001:Gfra1 UTSW 19 58300275 missense probably damaging 1.00
R2866:Gfra1 UTSW 19 58239307 missense possibly damaging 0.93
R3416:Gfra1 UTSW 19 58267112 missense probably damaging 1.00
R4352:Gfra1 UTSW 19 58267024 missense probably benign 0.08
R4564:Gfra1 UTSW 19 58239250 splice site probably null
R4727:Gfra1 UTSW 19 58263954 missense probably damaging 0.96
R4755:Gfra1 UTSW 19 58453244 missense probably damaging 1.00
R4914:Gfra1 UTSW 19 58267090 missense probably damaging 1.00
R4915:Gfra1 UTSW 19 58267090 missense probably damaging 1.00
R4917:Gfra1 UTSW 19 58267090 missense probably damaging 1.00
R5813:Gfra1 UTSW 19 58239255 missense probably benign
R6225:Gfra1 UTSW 19 58238398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGTTACAAACAGTCCCCTGAAG -3'
(R):5'- CCAGCTTGTTGGGAAGGAGCTATC -3'

Sequencing Primer
(F):5'- CAGTTCTTCAACAGAAGCCTGTG -3'
(R):5'- ACGGGTAAAATCCAACCTGAG -3'
Posted On2014-05-23