Incidental Mutation 'R1411:Wdr12'
ID200788
Institutional Source Beutler Lab
Gene Symbol Wdr12
Ensembl Gene ENSMUSG00000026019
Gene NameWD repeat domain 12
SynonymsYtm1p, 4933402C23Rik, Ytm1
MMRRC Submission 039467-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R1411 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location60069785-60098645 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60088072 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 141 (D141E)
Ref Sequence ENSEMBL: ENSMUSP00000117391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027173] [ENSMUST00000117438] [ENSMUST00000122038] [ENSMUST00000141417] [ENSMUST00000143342]
Predicted Effect probably benign
Transcript: ENSMUST00000027173
AA Change: D141E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027173
Gene: ENSMUSG00000026019
AA Change: D141E

DomainStartEndE-ValueType
Pfam:NLE 3 70 1.4e-20 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
WD40 129 171 5.77e-5 SMART
WD40 178 217 2.04e-5 SMART
WD40 246 284 1.41e-8 SMART
WD40 287 325 2.69e-5 SMART
WD40 331 371 4.34e-9 SMART
WD40 375 413 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117438
AA Change: D141E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113494
Gene: ENSMUSG00000026019
AA Change: D141E

DomainStartEndE-ValueType
Pfam:NLE 4 70 2e-19 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
WD40 129 171 5.77e-5 SMART
WD40 178 217 2.04e-5 SMART
WD40 246 284 1.41e-8 SMART
WD40 287 325 2.69e-5 SMART
WD40 331 371 4.34e-9 SMART
WD40 375 413 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122038
AA Change: D141E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113148
Gene: ENSMUSG00000026019
AA Change: D141E

DomainStartEndE-ValueType
Pfam:NLE 3 70 1.4e-20 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
WD40 129 171 5.77e-5 SMART
WD40 178 217 2.04e-5 SMART
WD40 246 284 1.41e-8 SMART
WD40 287 325 2.69e-5 SMART
WD40 331 371 4.34e-9 SMART
WD40 375 413 3e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136461
Predicted Effect probably benign
Transcript: ENSMUST00000141417
AA Change: D141E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117747
Gene: ENSMUSG00000026019
AA Change: D141E

DomainStartEndE-ValueType
Pfam:NLE 3 70 3.2e-22 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
Blast:WD40 129 151 4e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000143342
AA Change: D141E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117391
Gene: ENSMUSG00000026019
AA Change: D141E

DomainStartEndE-ValueType
Pfam:NLE 3 70 3.2e-22 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
Blast:WD40 129 151 4e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147413
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein is highly similar to the mouse WD repeat domain 12 protein at the amino acid level. The protein encoded by this gene is a component of a nucleolar protein complex that affects maturation of the large ribosomal subunit.[provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,730 I85F probably damaging Het
Acp4 A G 7: 44,256,843 probably benign Het
Baz1b T C 5: 135,230,323 F1080L possibly damaging Het
Cbx5 A T 15: 103,213,120 M30K probably benign Het
Cdc73 A G 1: 143,609,514 probably benign Het
Cdcp1 A T 9: 123,190,112 L34Q probably damaging Het
Chd8 C T 14: 52,224,646 V738I probably benign Het
Cpeb2 T G 5: 43,233,770 probably benign Het
Cyp2c67 T A 19: 39,638,591 D265V probably damaging Het
Cyp2j11 A G 4: 96,345,216 I81T probably benign Het
Dbx2 T C 15: 95,632,381 E235G probably damaging Het
Dgkq C A 5: 108,650,362 V677F probably damaging Het
Ercc5 A G 1: 44,178,281 N928S probably damaging Het
Flt1 C T 5: 147,580,316 V1054M probably damaging Het
Flywch1 T C 17: 23,755,824 D614G probably damaging Het
Frmd3 T C 4: 74,153,621 F247L probably damaging Het
Gm1527 A G 3: 28,914,483 N228S probably benign Het
Gm8979 C T 7: 106,083,479 A190T probably benign Het
Gpld1 T A 13: 24,962,808 L251Q probably damaging Het
Gzma C T 13: 113,096,208 V117I probably benign Het
Hydin C A 8: 110,575,031 T3798K probably benign Het
Il1rapl1 T A X: 86,747,298 S679C possibly damaging Het
Lrrc8c G A 5: 105,608,179 A607T probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mfsd4b4 A T 10: 39,892,140 M319K probably damaging Het
Mroh2b A C 15: 4,918,317 H538P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup188 A G 2: 30,343,795 T1733A probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Ofcc1 A G 13: 40,142,787 S524P probably benign Het
Olfr986 C T 9: 40,187,139 T8I possibly damaging Het
Padi4 C T 4: 140,752,603 S413N probably damaging Het
Pdzrn4 A G 15: 92,771,013 *1015W probably null Het
Pkhd1 G A 1: 20,373,896 P2314L probably damaging Het
Serpinb9c C G 13: 33,151,834 V212L probably benign Het
Slc25a23 A G 17: 57,059,622 F18L probably damaging Het
Smarca4 C A 9: 21,658,955 N751K probably damaging Het
Tfip11 G T 5: 112,333,033 V292L probably benign Het
Tnrc18 T C 5: 142,765,947 K1201R unknown Het
Vmn1r199 T C 13: 22,383,501 F322L probably benign Het
Vmn1r201 T C 13: 22,474,679 V21A probably benign Het
Vmn2r108 A T 17: 20,462,845 I699K probably damaging Het
Vmn2r117 T C 17: 23,460,553 N566D probably damaging Het
Zfp974 A G 7: 27,911,209 S364P probably benign Het
Other mutations in Wdr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Wdr12 APN 1 60080559 missense probably damaging 1.00
R0313:Wdr12 UTSW 1 60082579 missense possibly damaging 0.92
R0684:Wdr12 UTSW 1 60089366 splice site probably benign
R1157:Wdr12 UTSW 1 60078230 missense probably damaging 1.00
R1539:Wdr12 UTSW 1 60083848 splice site probably null
R2075:Wdr12 UTSW 1 60091063 missense possibly damaging 0.77
R3113:Wdr12 UTSW 1 60087062 missense probably benign 0.01
R4533:Wdr12 UTSW 1 60078195 missense probably benign 0.05
R5153:Wdr12 UTSW 1 60094511 missense possibly damaging 0.81
R5196:Wdr12 UTSW 1 60087084 missense probably damaging 1.00
R6603:Wdr12 UTSW 1 60082624 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACACCAGGCATGAACACTTTACAC -3'
(R):5'- CCTGCTGTCAAAGAGGTATGAATGCTAA -3'

Sequencing Primer
(F):5'- TGCAGCAAATACTCAGACACATAAAG -3'
(R):5'- actcgtgcttctgtcttcc -3'
Posted On2014-05-23