Incidental Mutation 'R1411:Frmd3'
ID200792
Institutional Source Beutler Lab
Gene Symbol Frmd3
Ensembl Gene ENSMUSG00000049122
Gene NameFERM domain containing 3
Synonyms4.1O, EPB41L4O, P410, 9430066I12Rik
MMRRC Submission 039467-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R1411 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location74013442-74202214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74153621 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 247 (F247L)
Ref Sequence ENSEMBL: ENSMUSP00000095615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084474] [ENSMUST00000098006]
Predicted Effect probably damaging
Transcript: ENSMUST00000084474
AA Change: F247L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081514
Gene: ENSMUSG00000049122
AA Change: F247L

DomainStartEndE-ValueType
B41 28 225 5.17e-57 SMART
FERM_C 229 316 1.93e-18 SMART
FA 322 368 4.1e-13 SMART
low complexity region 391 401 N/A INTRINSIC
transmembrane domain 530 552 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098006
AA Change: F247L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095615
Gene: ENSMUSG00000049122
AA Change: F247L

DomainStartEndE-ValueType
B41 28 225 5.17e-57 SMART
FERM_C 229 316 1.93e-18 SMART
FA 322 368 4.1e-13 SMART
low complexity region 391 401 N/A INTRINSIC
transmembrane domain 529 551 N/A INTRINSIC
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single pass membrane protein primarily found in ovaries. A similar protein in erythrocytes helps determine the shape of red blood cells, but the function of the encoded protein has not been determined. There is some evidence that this is a tumor suppressor gene, and there is also evidence linking defects in this gene to susceptibility to diabetic nephropathy in type 1 diabetes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,730 I85F probably damaging Het
Acp4 A G 7: 44,256,843 probably benign Het
Baz1b T C 5: 135,230,323 F1080L possibly damaging Het
Cbx5 A T 15: 103,213,120 M30K probably benign Het
Cdc73 A G 1: 143,609,514 probably benign Het
Cdcp1 A T 9: 123,190,112 L34Q probably damaging Het
Chd8 C T 14: 52,224,646 V738I probably benign Het
Cpeb2 T G 5: 43,233,770 probably benign Het
Cyp2c67 T A 19: 39,638,591 D265V probably damaging Het
Cyp2j11 A G 4: 96,345,216 I81T probably benign Het
Dbx2 T C 15: 95,632,381 E235G probably damaging Het
Dgkq C A 5: 108,650,362 V677F probably damaging Het
Ercc5 A G 1: 44,178,281 N928S probably damaging Het
Flt1 C T 5: 147,580,316 V1054M probably damaging Het
Flywch1 T C 17: 23,755,824 D614G probably damaging Het
Gm1527 A G 3: 28,914,483 N228S probably benign Het
Gm8979 C T 7: 106,083,479 A190T probably benign Het
Gpld1 T A 13: 24,962,808 L251Q probably damaging Het
Gzma C T 13: 113,096,208 V117I probably benign Het
Hydin C A 8: 110,575,031 T3798K probably benign Het
Il1rapl1 T A X: 86,747,298 S679C possibly damaging Het
Lrrc8c G A 5: 105,608,179 A607T probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mfsd4b4 A T 10: 39,892,140 M319K probably damaging Het
Mroh2b A C 15: 4,918,317 H538P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup188 A G 2: 30,343,795 T1733A probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Ofcc1 A G 13: 40,142,787 S524P probably benign Het
Olfr986 C T 9: 40,187,139 T8I possibly damaging Het
Padi4 C T 4: 140,752,603 S413N probably damaging Het
Pdzrn4 A G 15: 92,771,013 *1015W probably null Het
Pkhd1 G A 1: 20,373,896 P2314L probably damaging Het
Serpinb9c C G 13: 33,151,834 V212L probably benign Het
Slc25a23 A G 17: 57,059,622 F18L probably damaging Het
Smarca4 C A 9: 21,658,955 N751K probably damaging Het
Tfip11 G T 5: 112,333,033 V292L probably benign Het
Tnrc18 T C 5: 142,765,947 K1201R unknown Het
Vmn1r199 T C 13: 22,383,501 F322L probably benign Het
Vmn1r201 T C 13: 22,474,679 V21A probably benign Het
Vmn2r108 A T 17: 20,462,845 I699K probably damaging Het
Vmn2r117 T C 17: 23,460,553 N566D probably damaging Het
Wdr12 A T 1: 60,088,072 D141E probably benign Het
Zfp974 A G 7: 27,911,209 S364P probably benign Het
Other mutations in Frmd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Frmd3 APN 4 74074120 missense possibly damaging 0.62
IGL01774:Frmd3 APN 4 74187838 missense probably damaging 1.00
IGL02213:Frmd3 APN 4 74135872 missense probably benign 0.36
IGL02479:Frmd3 APN 4 74187515 missense probably benign 0.30
IGL03248:Frmd3 APN 4 74128218 missense possibly damaging 0.71
R0765:Frmd3 UTSW 4 74161767 missense probably damaging 1.00
R1535:Frmd3 UTSW 4 74013758 start gained probably benign
R1990:Frmd3 UTSW 4 74187439 missense probably damaging 1.00
R3898:Frmd3 UTSW 4 74074109 missense probably damaging 1.00
R4377:Frmd3 UTSW 4 74128298 critical splice donor site probably null
R4616:Frmd3 UTSW 4 74187872 missense probably benign 0.15
R4965:Frmd3 UTSW 4 74153600 missense probably damaging 1.00
R5024:Frmd3 UTSW 4 74098144 missense probably benign 0.00
R5104:Frmd3 UTSW 4 74145078 missense probably damaging 1.00
R5418:Frmd3 UTSW 4 74161698 critical splice acceptor site probably null
R5434:Frmd3 UTSW 4 74187796 missense probably damaging 1.00
R5878:Frmd3 UTSW 4 74153610 missense probably damaging 1.00
R5999:Frmd3 UTSW 4 74170691 missense possibly damaging 0.49
R6031:Frmd3 UTSW 4 74187451 missense probably damaging 0.99
R6031:Frmd3 UTSW 4 74187451 missense probably damaging 0.99
R6616:Frmd3 UTSW 4 74187488 missense probably damaging 0.97
R6813:Frmd3 UTSW 4 74159245 missense probably benign 0.00
R6941:Frmd3 UTSW 4 74098126 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TGGCCTTGATTCAAATTAGCCCACG -3'
(R):5'- CGCTCAGGTGAATCCCACTCACTC -3'

Sequencing Primer
(F):5'- TTCAAATTAGCCCACGATGAAGG -3'
(R):5'- AACTACCTGAAAGTTTCAGAAAGAAA -3'
Posted On2014-05-23