Incidental Mutation 'R1411:Cpeb2'
ID200797
Institutional Source Beutler Lab
Gene Symbol Cpeb2
Ensembl Gene ENSMUSG00000039782
Gene Namecytoplasmic polyadenylation element binding protein 2
SynonymsA630055H10Rik
MMRRC Submission 039467-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R1411 (G1)
Quality Score114
Status Validated
Chromosome5
Chromosomal Location43233170-43289724 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to G at 43233770 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114066] [ENSMUST00000166713] [ENSMUST00000169035]
Predicted Effect probably benign
Transcript: ENSMUST00000114065
SMART Domains Protein: ENSMUSP00000109699
Gene: ENSMUSG00000039782

DomainStartEndE-ValueType
low complexity region 3 41 N/A INTRINSIC
RRM 265 337 1.5e-4 SMART
RRM 373 446 1.86e-2 SMART
PDB:2M13|A 447 512 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114066
SMART Domains Protein: ENSMUSP00000109700
Gene: ENSMUSG00000039782

DomainStartEndE-ValueType
low complexity region 3 41 N/A INTRINSIC
low complexity region 222 232 N/A INTRINSIC
RRM 273 345 1.5e-4 SMART
RRM 381 454 1.86e-2 SMART
PDB:2M13|A 455 520 1e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140650
SMART Domains Protein: ENSMUSP00000130435
Gene: ENSMUSG00000085720

DomainStartEndE-ValueType
low complexity region 52 66 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000166713
AA Change: L103R
SMART Domains Protein: ENSMUSP00000130921
Gene: ENSMUSG00000039782
AA Change: L103R

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 53 N/A INTRINSIC
low complexity region 56 79 N/A INTRINSIC
low complexity region 142 156 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
low complexity region 178 199 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
low complexity region 245 276 N/A INTRINSIC
low complexity region 279 293 N/A INTRINSIC
low complexity region 342 369 N/A INTRINSIC
low complexity region 375 433 N/A INTRINSIC
low complexity region 451 460 N/A INTRINSIC
low complexity region 471 481 N/A INTRINSIC
low complexity region 489 534 N/A INTRINSIC
RRM 758 830 1.5e-4 SMART
RRM 866 939 1.86e-2 SMART
PDB:2M13|A 940 1005 2e-6 PDB
Predicted Effect unknown
Transcript: ENSMUST00000169035
AA Change: L103R
SMART Domains Protein: ENSMUSP00000125857
Gene: ENSMUSG00000039782
AA Change: L103R

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 53 N/A INTRINSIC
low complexity region 56 79 N/A INTRINSIC
low complexity region 142 156 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
low complexity region 178 199 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
low complexity region 245 276 N/A INTRINSIC
low complexity region 279 293 N/A INTRINSIC
low complexity region 342 369 N/A INTRINSIC
low complexity region 375 433 N/A INTRINSIC
low complexity region 451 460 N/A INTRINSIC
low complexity region 471 481 N/A INTRINSIC
low complexity region 489 534 N/A INTRINSIC
low complexity region 685 695 N/A INTRINSIC
RRM 736 808 1.5e-4 SMART
RRM 844 917 1.86e-2 SMART
PDB:2M13|A 918 983 2e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200685
Meta Mutation Damage Score 0.292 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to cytoplasmic polyadenylation element binding protein (CPEB), an mRNA-binding protein that regulates cytoplasmic polyadenylation of mRNA as a trans factor in oogenesis and spermatogenesis. Studies of the similar gene in mice suggested a possible role of this protein in transcriptionally inactive haploid spermatids. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early postnatal lethality, decreased heart rate, and increased parasympathetic signaling leading to increased pulmonary acetylcholine level, bronchoconstriction, severe apnea, and abnormal breathing patterns. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,730 I85F probably damaging Het
Acp4 A G 7: 44,256,843 probably benign Het
Baz1b T C 5: 135,230,323 F1080L possibly damaging Het
Cbx5 A T 15: 103,213,120 M30K probably benign Het
Cdc73 A G 1: 143,609,514 probably benign Het
Cdcp1 A T 9: 123,190,112 L34Q probably damaging Het
Chd8 C T 14: 52,224,646 V738I probably benign Het
Cyp2c67 T A 19: 39,638,591 D265V probably damaging Het
Cyp2j11 A G 4: 96,345,216 I81T probably benign Het
Dbx2 T C 15: 95,632,381 E235G probably damaging Het
Dgkq C A 5: 108,650,362 V677F probably damaging Het
Ercc5 A G 1: 44,178,281 N928S probably damaging Het
Flt1 C T 5: 147,580,316 V1054M probably damaging Het
Flywch1 T C 17: 23,755,824 D614G probably damaging Het
Frmd3 T C 4: 74,153,621 F247L probably damaging Het
Gm1527 A G 3: 28,914,483 N228S probably benign Het
Gm8979 C T 7: 106,083,479 A190T probably benign Het
Gpld1 T A 13: 24,962,808 L251Q probably damaging Het
Gzma C T 13: 113,096,208 V117I probably benign Het
Hydin C A 8: 110,575,031 T3798K probably benign Het
Il1rapl1 T A X: 86,747,298 S679C possibly damaging Het
Lrrc8c G A 5: 105,608,179 A607T probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mfsd4b4 A T 10: 39,892,140 M319K probably damaging Het
Mroh2b A C 15: 4,918,317 H538P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup188 A G 2: 30,343,795 T1733A probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Ofcc1 A G 13: 40,142,787 S524P probably benign Het
Olfr986 C T 9: 40,187,139 T8I possibly damaging Het
Padi4 C T 4: 140,752,603 S413N probably damaging Het
Pdzrn4 A G 15: 92,771,013 *1015W probably null Het
Pkhd1 G A 1: 20,373,896 P2314L probably damaging Het
Serpinb9c C G 13: 33,151,834 V212L probably benign Het
Slc25a23 A G 17: 57,059,622 F18L probably damaging Het
Smarca4 C A 9: 21,658,955 N751K probably damaging Het
Tfip11 G T 5: 112,333,033 V292L probably benign Het
Tnrc18 T C 5: 142,765,947 K1201R unknown Het
Vmn1r199 T C 13: 22,383,501 F322L probably benign Het
Vmn1r201 T C 13: 22,474,679 V21A probably benign Het
Vmn2r108 A T 17: 20,462,845 I699K probably damaging Het
Vmn2r117 T C 17: 23,460,553 N566D probably damaging Het
Wdr12 A T 1: 60,088,072 D141E probably benign Het
Zfp974 A G 7: 27,911,209 S364P probably benign Het
Other mutations in Cpeb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Cpeb2 APN 5 43285831 missense probably damaging 0.98
IGL00771:Cpeb2 APN 5 43237547 missense possibly damaging 0.94
IGL00797:Cpeb2 APN 5 43281447 missense probably damaging 1.00
IGL01604:Cpeb2 APN 5 43278695 critical splice donor site probably null
IGL01632:Cpeb2 APN 5 43237422 missense probably benign 0.25
IGL03137:Cpeb2 APN 5 43261724 splice site probably benign
R0125:Cpeb2 UTSW 5 43238400 intron probably benign
R0200:Cpeb2 UTSW 5 43261776 missense possibly damaging 0.57
R0453:Cpeb2 UTSW 5 43285713 splice site probably benign
R1542:Cpeb2 UTSW 5 43285875 missense probably damaging 1.00
R1563:Cpeb2 UTSW 5 43285737 missense probably damaging 1.00
R1573:Cpeb2 UTSW 5 43283930 splice site probably benign
R1703:Cpeb2 UTSW 5 43233838 unclassified probably benign
R1899:Cpeb2 UTSW 5 43277587 missense probably damaging 1.00
R1942:Cpeb2 UTSW 5 43235253 intron probably benign
R3429:Cpeb2 UTSW 5 43281230 critical splice donor site probably null
R3610:Cpeb2 UTSW 5 43285933 missense probably damaging 0.98
R3848:Cpeb2 UTSW 5 43237445 missense probably damaging 0.97
R4005:Cpeb2 UTSW 5 43238412 intron probably benign
R4306:Cpeb2 UTSW 5 43235235 intron probably benign
R4667:Cpeb2 UTSW 5 43233892 unclassified probably benign
R4754:Cpeb2 UTSW 5 43285857 missense possibly damaging 0.93
R4821:Cpeb2 UTSW 5 43233474 unclassified probably benign
R4906:Cpeb2 UTSW 5 43244662 missense possibly damaging 0.50
R5237:Cpeb2 UTSW 5 43285756 missense probably damaging 0.99
R6693:Cpeb2 UTSW 5 43285912 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGCCTGATAAATGCGGGACTTC -3'
(R):5'- GTGTGGCGGGCTCAACTCTTTC -3'

Sequencing Primer
(F):5'- TGCTGCACACTGCCCTG -3'
(R):5'- TGCTGCCGCTTACTGAAG -3'
Posted On2014-05-23