Incidental Mutation 'R1411:Dgkq'
ID200799
Institutional Source Beutler Lab
Gene Symbol Dgkq
Ensembl Gene ENSMUSG00000004815
Gene Namediacylglycerol kinase, theta
Synonyms110kDa, DAGK7, Dagk4, Dgkd, Dgk theta
MMRRC Submission 039467-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R1411 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location108646693-108669672 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108650362 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 677 (V677F)
Ref Sequence ENSEMBL: ENSMUSP00000057859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053913] [ENSMUST00000063272] [ENSMUST00000078323] [ENSMUST00000120327] [ENSMUST00000132179] [ENSMUST00000132708] [ENSMUST00000153238]
Predicted Effect probably damaging
Transcript: ENSMUST00000053913
AA Change: V677F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057859
Gene: ENSMUSG00000004815
AA Change: V677F

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
C1 114 162 1.73e-2 SMART
C1 178 228 1.58e-13 SMART
low complexity region 267 275 N/A INTRINSIC
RA 387 486 2.08e-20 SMART
DAGKc 580 707 4.79e-63 SMART
DAGKa 733 885 7e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063272
SMART Domains Protein: ENSMUSP00000068607
Gene: ENSMUSG00000013495

DomainStartEndE-ValueType
Pfam:DUF1211 31 121 7.3e-28 PFAM
transmembrane domain 135 157 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
Pfam:DUF1211 256 353 4.4e-36 PFAM
transmembrane domain 373 395 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
transmembrane domain 450 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078323
SMART Domains Protein: ENSMUSP00000077437
Gene: ENSMUSG00000013495

DomainStartEndE-ValueType
Pfam:DUF1211 31 121 7.3e-28 PFAM
transmembrane domain 135 157 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
Pfam:DUF1211 256 353 4.4e-36 PFAM
transmembrane domain 373 395 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
transmembrane domain 450 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120327
SMART Domains Protein: ENSMUSP00000112780
Gene: ENSMUSG00000013495

DomainStartEndE-ValueType
Pfam:DUF1211 32 121 1.5e-22 PFAM
transmembrane domain 135 157 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
Pfam:DUF1211 257 353 9.5e-27 PFAM
transmembrane domain 373 395 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
transmembrane domain 450 472 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123669
Predicted Effect probably benign
Transcript: ENSMUST00000132179
SMART Domains Protein: ENSMUSP00000118466
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
Blast:C1 114 144 1e-12 BLAST
low complexity region 156 169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132708
SMART Domains Protein: ENSMUSP00000122837
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
Blast:C1 26 56 2e-13 BLAST
low complexity region 68 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145917
Predicted Effect probably benign
Transcript: ENSMUST00000153238
SMART Domains Protein: ENSMUSP00000118065
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
Blast:C1 114 144 1e-12 BLAST
low complexity region 156 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156964
Meta Mutation Damage Score 0.364 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains three cysteine-rich domains, a proline-rich region, and a pleckstrin homology domain with an overlapping Ras-associating domain. It is localized in the speckle domains of the nucleus, and mediates the regeneration of phosphatidylinositol (PI) from diacylglycerol in the PI-cycle during cell signal transduction. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,730 I85F probably damaging Het
Acp4 A G 7: 44,256,843 probably benign Het
Baz1b T C 5: 135,230,323 F1080L possibly damaging Het
Cbx5 A T 15: 103,213,120 M30K probably benign Het
Cdc73 A G 1: 143,609,514 probably benign Het
Cdcp1 A T 9: 123,190,112 L34Q probably damaging Het
Chd8 C T 14: 52,224,646 V738I probably benign Het
Cpeb2 T G 5: 43,233,770 probably benign Het
Cyp2c67 T A 19: 39,638,591 D265V probably damaging Het
Cyp2j11 A G 4: 96,345,216 I81T probably benign Het
Dbx2 T C 15: 95,632,381 E235G probably damaging Het
Ercc5 A G 1: 44,178,281 N928S probably damaging Het
Flt1 C T 5: 147,580,316 V1054M probably damaging Het
Flywch1 T C 17: 23,755,824 D614G probably damaging Het
Frmd3 T C 4: 74,153,621 F247L probably damaging Het
Gm1527 A G 3: 28,914,483 N228S probably benign Het
Gm8979 C T 7: 106,083,479 A190T probably benign Het
Gpld1 T A 13: 24,962,808 L251Q probably damaging Het
Gzma C T 13: 113,096,208 V117I probably benign Het
Hydin C A 8: 110,575,031 T3798K probably benign Het
Il1rapl1 T A X: 86,747,298 S679C possibly damaging Het
Lrrc8c G A 5: 105,608,179 A607T probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mfsd4b4 A T 10: 39,892,140 M319K probably damaging Het
Mroh2b A C 15: 4,918,317 H538P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup188 A G 2: 30,343,795 T1733A probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Ofcc1 A G 13: 40,142,787 S524P probably benign Het
Olfr986 C T 9: 40,187,139 T8I possibly damaging Het
Padi4 C T 4: 140,752,603 S413N probably damaging Het
Pdzrn4 A G 15: 92,771,013 *1015W probably null Het
Pkhd1 G A 1: 20,373,896 P2314L probably damaging Het
Serpinb9c C G 13: 33,151,834 V212L probably benign Het
Slc25a23 A G 17: 57,059,622 F18L probably damaging Het
Smarca4 C A 9: 21,658,955 N751K probably damaging Het
Tfip11 G T 5: 112,333,033 V292L probably benign Het
Tnrc18 T C 5: 142,765,947 K1201R unknown Het
Vmn1r199 T C 13: 22,383,501 F322L probably benign Het
Vmn1r201 T C 13: 22,474,679 V21A probably benign Het
Vmn2r108 A T 17: 20,462,845 I699K probably damaging Het
Vmn2r117 T C 17: 23,460,553 N566D probably damaging Het
Wdr12 A T 1: 60,088,072 D141E probably benign Het
Zfp974 A G 7: 27,911,209 S364P probably benign Het
Other mutations in Dgkq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Dgkq APN 5 108654582 missense possibly damaging 0.72
IGL02364:Dgkq APN 5 108656444 missense probably benign 0.05
IGL02966:Dgkq APN 5 108656421 splice site probably null
IGL03297:Dgkq APN 5 108650274 missense probably damaging 1.00
R0179:Dgkq UTSW 5 108658200 splice site probably benign
R0194:Dgkq UTSW 5 108654644 intron probably benign
R0332:Dgkq UTSW 5 108655099 splice site probably benign
R0513:Dgkq UTSW 5 108656495 missense probably benign 0.02
R0525:Dgkq UTSW 5 108654615 missense probably damaging 1.00
R0673:Dgkq UTSW 5 108655589 missense probably damaging 0.97
R0801:Dgkq UTSW 5 108660720 utr 5 prime probably null
R0850:Dgkq UTSW 5 108654578 missense possibly damaging 0.82
R0944:Dgkq UTSW 5 108656465 missense probably damaging 1.00
R1069:Dgkq UTSW 5 108656037 splice site probably benign
R1488:Dgkq UTSW 5 108650877 missense probably damaging 1.00
R1858:Dgkq UTSW 5 108653731 missense probably benign 0.00
R1874:Dgkq UTSW 5 108660595 missense probably benign 0.07
R2210:Dgkq UTSW 5 108660523 missense probably damaging 1.00
R4499:Dgkq UTSW 5 108649661 missense possibly damaging 0.54
R5061:Dgkq UTSW 5 108654123 missense probably benign 0.02
R5474:Dgkq UTSW 5 108649143 critical splice donor site probably null
R5481:Dgkq UTSW 5 108648810 unclassified probably null
R5951:Dgkq UTSW 5 108654370 missense probably damaging 1.00
R6193:Dgkq UTSW 5 108655500 nonsense probably null
R6429:Dgkq UTSW 5 108653708 missense probably damaging 1.00
R6458:Dgkq UTSW 5 108654376 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGCTTCAGTCAACAAGTTCCTGCTC -3'
(R):5'- GTGGCAGAATACTGTCTCCCACAC -3'

Sequencing Primer
(F):5'- GGGAGCCATATGTAAGATTCTAGC -3'
(R):5'- GAATACTGTCTCCCACACAGGTTC -3'
Posted On2014-05-23