Incidental Mutation 'R1411:Abhd8'
ID200807
Institutional Source Beutler Lab
Gene Symbol Abhd8
Ensembl Gene ENSMUSG00000007950
Gene Nameabhydrolase domain containing 8
Synonyms0910001L24Rik
MMRRC Submission 039467-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R1411 (G1)
Quality Score167
Status Validated
Chromosome8
Chromosomal Location71456705-71463655 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71461730 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 85 (I85F)
Ref Sequence ENSEMBL: ENSMUSP00000008094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008094] [ENSMUST00000048914]
Predicted Effect probably damaging
Transcript: ENSMUST00000008094
AA Change: I85F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008094
Gene: ENSMUSG00000007950
AA Change: I85F

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 139 148 N/A INTRINSIC
Pfam:Hydrolase_4 164 397 2e-17 PFAM
Pfam:Abhydrolase_1 168 289 1.2e-19 PFAM
Pfam:Abhydrolase_5 168 391 2.4e-20 PFAM
Pfam:Abhydrolase_6 170 403 1.4e-17 PFAM
low complexity region 411 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048914
SMART Domains Protein: ENSMUSP00000044497
Gene: ENSMUSG00000034880

DomainStartEndE-ValueType
Pfam:Ribosomal_L34 49 92 1.6e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212503
Meta Mutation Damage Score 0.302 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is upstream of, and in a head-to-head orientation with the gene for the mitochondrial ribosomal protein L34. The predicted protein contains alpha/beta hydrolase fold and secretory lipase domains. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp4 A G 7: 44,256,843 probably benign Het
Baz1b T C 5: 135,230,323 F1080L possibly damaging Het
Cbx5 A T 15: 103,213,120 M30K probably benign Het
Cdc73 A G 1: 143,609,514 probably benign Het
Cdcp1 A T 9: 123,190,112 L34Q probably damaging Het
Chd8 C T 14: 52,224,646 V738I probably benign Het
Cpeb2 T G 5: 43,233,770 probably benign Het
Cyp2c67 T A 19: 39,638,591 D265V probably damaging Het
Cyp2j11 A G 4: 96,345,216 I81T probably benign Het
Dbx2 T C 15: 95,632,381 E235G probably damaging Het
Dgkq C A 5: 108,650,362 V677F probably damaging Het
Ercc5 A G 1: 44,178,281 N928S probably damaging Het
Flt1 C T 5: 147,580,316 V1054M probably damaging Het
Flywch1 T C 17: 23,755,824 D614G probably damaging Het
Frmd3 T C 4: 74,153,621 F247L probably damaging Het
Gm1527 A G 3: 28,914,483 N228S probably benign Het
Gm8979 C T 7: 106,083,479 A190T probably benign Het
Gpld1 T A 13: 24,962,808 L251Q probably damaging Het
Gzma C T 13: 113,096,208 V117I probably benign Het
Hydin C A 8: 110,575,031 T3798K probably benign Het
Il1rapl1 T A X: 86,747,298 S679C possibly damaging Het
Lrrc8c G A 5: 105,608,179 A607T probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mfsd4b4 A T 10: 39,892,140 M319K probably damaging Het
Mroh2b A C 15: 4,918,317 H538P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup188 A G 2: 30,343,795 T1733A probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Ofcc1 A G 13: 40,142,787 S524P probably benign Het
Olfr986 C T 9: 40,187,139 T8I possibly damaging Het
Padi4 C T 4: 140,752,603 S413N probably damaging Het
Pdzrn4 A G 15: 92,771,013 *1015W probably null Het
Pkhd1 G A 1: 20,373,896 P2314L probably damaging Het
Serpinb9c C G 13: 33,151,834 V212L probably benign Het
Slc25a23 A G 17: 57,059,622 F18L probably damaging Het
Smarca4 C A 9: 21,658,955 N751K probably damaging Het
Tfip11 G T 5: 112,333,033 V292L probably benign Het
Tnrc18 T C 5: 142,765,947 K1201R unknown Het
Vmn1r199 T C 13: 22,383,501 F322L probably benign Het
Vmn1r201 T C 13: 22,474,679 V21A probably benign Het
Vmn2r108 A T 17: 20,462,845 I699K probably damaging Het
Vmn2r117 T C 17: 23,460,553 N566D probably damaging Het
Wdr12 A T 1: 60,088,072 D141E probably benign Het
Zfp974 A G 7: 27,911,209 S364P probably benign Het
Other mutations in Abhd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Abhd8 APN 8 71457319 missense probably damaging 1.00
IGL01780:Abhd8 APN 8 71461477 missense probably benign 0.00
IGL02350:Abhd8 APN 8 71461477 missense probably benign 0.00
IGL02357:Abhd8 APN 8 71461477 missense probably benign 0.00
PIT4142001:Abhd8 UTSW 8 71461855 missense probably damaging 1.00
R0135:Abhd8 UTSW 8 71458074 missense probably benign 0.20
R0142:Abhd8 UTSW 8 71461862 missense probably damaging 0.96
R1006:Abhd8 UTSW 8 71458441 missense probably benign 0.19
R1676:Abhd8 UTSW 8 71461873 missense probably damaging 1.00
R1937:Abhd8 UTSW 8 71461862 missense possibly damaging 0.93
R1985:Abhd8 UTSW 8 71463513 unclassified probably benign
R3724:Abhd8 UTSW 8 71461492 missense probably benign 0.14
R5254:Abhd8 UTSW 8 71458398 nonsense probably null
R5770:Abhd8 UTSW 8 71457328 missense probably benign 0.07
R6030:Abhd8 UTSW 8 71458150 missense possibly damaging 0.94
R6030:Abhd8 UTSW 8 71458150 missense possibly damaging 0.94
R6474:Abhd8 UTSW 8 71461715 missense probably damaging 1.00
R6501:Abhd8 UTSW 8 71461521 nonsense probably null
R6769:Abhd8 UTSW 8 71461461 missense probably damaging 1.00
R6771:Abhd8 UTSW 8 71461461 missense probably damaging 1.00
Z1088:Abhd8 UTSW 8 71461801 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACCGACTCCGTGAATGAAGAACAG -3'
(R):5'- TGCTTACCCGATGCAAGACCAGAG -3'

Sequencing Primer
(F):5'- ATGCGCTGCTCACAGTC -3'
(R):5'- ACACACCATGCTGACTGGG -3'
Posted On2014-05-23