Incidental Mutation 'R1411:Smarca4'
ID200810
Institutional Source Beutler Lab
Gene Symbol Smarca4
Ensembl Gene ENSMUSG00000032187
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
SynonymsSNF2beta, SW1/SNF, b2b508.1Clo, Brg1, b2b692Clo
MMRRC Submission 039467-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1411 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21616169-21704230 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 21658955 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 751 (N751K)
Ref Sequence ENSEMBL: ENSMUSP00000133922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034707] [ENSMUST00000098948] [ENSMUST00000174008]
Predicted Effect probably damaging
Transcript: ENSMUST00000034707
AA Change: N751K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034707
Gene: ENSMUSG00000032187
AA Change: N751K

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1360 1385 N/A INTRINSIC
low complexity region 1388 1398 N/A INTRINSIC
BROMO 1422 1533 4.19e-42 SMART
low complexity region 1534 1557 N/A INTRINSIC
low complexity region 1578 1588 N/A INTRINSIC
low complexity region 1594 1614 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098948
AA Change: N751K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096547
Gene: ENSMUSG00000032187
AA Change: N751K

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1363 1388 N/A INTRINSIC
low complexity region 1391 1401 N/A INTRINSIC
BROMO 1425 1536 4.19e-42 SMART
low complexity region 1537 1560 N/A INTRINSIC
low complexity region 1581 1591 N/A INTRINSIC
low complexity region 1597 1617 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172996
AA Change: N555K
SMART Domains Protein: ENSMUSP00000133535
Gene: ENSMUSG00000032187
AA Change: N555K

DomainStartEndE-ValueType
low complexity region 26 52 N/A INTRINSIC
low complexity region 57 94 N/A INTRINSIC
low complexity region 109 135 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
HSA 265 337 2e-27 SMART
coiled coil region 367 399 N/A INTRINSIC
BRK 417 461 5.17e-21 SMART
low complexity region 462 477 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
DEXDc 555 747 5.17e-38 SMART
Blast:DEXDc 758 790 6e-10 BLAST
low complexity region 824 839 N/A INTRINSIC
HELICc 915 999 7.27e-24 SMART
low complexity region 1088 1105 N/A INTRINSIC
SnAC 1126 1194 2.8e-29 SMART
low complexity region 1201 1226 N/A INTRINSIC
low complexity region 1229 1239 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174008
AA Change: N751K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133922
Gene: ENSMUSG00000032187
AA Change: N751K

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1360 1385 N/A INTRINSIC
low complexity region 1388 1398 N/A INTRINSIC
BROMO 1422 1532 1.36e-41 SMART
low complexity region 1533 1556 N/A INTRINSIC
low complexity region 1577 1587 N/A INTRINSIC
low complexity region 1593 1613 N/A INTRINSIC
Meta Mutation Damage Score 0.0244 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. In addition, this protein can bind BRCA1, as well as regulate the expression of the tumorigenic protein CD44. Mutations in this gene cause rhabdoid tumor predisposition syndrome type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a null allele die in utero before implantation. Embryos heterozygous for this null allele and an ENU-induced allele show impaired definitive erythropoiesis, anemia and lethality during organogenesis. Heterozygotes for a different null allele show cyanosis and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,730 I85F probably damaging Het
Acp4 A G 7: 44,256,843 probably benign Het
Baz1b T C 5: 135,230,323 F1080L possibly damaging Het
Cbx5 A T 15: 103,213,120 M30K probably benign Het
Cdc73 A G 1: 143,609,514 probably benign Het
Cdcp1 A T 9: 123,190,112 L34Q probably damaging Het
Chd8 C T 14: 52,224,646 V738I probably benign Het
Cpeb2 T G 5: 43,233,770 probably benign Het
Cyp2c67 T A 19: 39,638,591 D265V probably damaging Het
Cyp2j11 A G 4: 96,345,216 I81T probably benign Het
Dbx2 T C 15: 95,632,381 E235G probably damaging Het
Dgkq C A 5: 108,650,362 V677F probably damaging Het
Ercc5 A G 1: 44,178,281 N928S probably damaging Het
Flt1 C T 5: 147,580,316 V1054M probably damaging Het
Flywch1 T C 17: 23,755,824 D614G probably damaging Het
Frmd3 T C 4: 74,153,621 F247L probably damaging Het
Gm1527 A G 3: 28,914,483 N228S probably benign Het
Gm8979 C T 7: 106,083,479 A190T probably benign Het
Gpld1 T A 13: 24,962,808 L251Q probably damaging Het
Gzma C T 13: 113,096,208 V117I probably benign Het
Hydin C A 8: 110,575,031 T3798K probably benign Het
Il1rapl1 T A X: 86,747,298 S679C possibly damaging Het
Lrrc8c G A 5: 105,608,179 A607T probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mfsd4b4 A T 10: 39,892,140 M319K probably damaging Het
Mroh2b A C 15: 4,918,317 H538P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup188 A G 2: 30,343,795 T1733A probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Ofcc1 A G 13: 40,142,787 S524P probably benign Het
Olfr986 C T 9: 40,187,139 T8I possibly damaging Het
Padi4 C T 4: 140,752,603 S413N probably damaging Het
Pdzrn4 A G 15: 92,771,013 *1015W probably null Het
Pkhd1 G A 1: 20,373,896 P2314L probably damaging Het
Serpinb9c C G 13: 33,151,834 V212L probably benign Het
Slc25a23 A G 17: 57,059,622 F18L probably damaging Het
Tfip11 G T 5: 112,333,033 V292L probably benign Het
Tnrc18 T C 5: 142,765,947 K1201R unknown Het
Vmn1r199 T C 13: 22,383,501 F322L probably benign Het
Vmn1r201 T C 13: 22,474,679 V21A probably benign Het
Vmn2r108 A T 17: 20,462,845 I699K probably damaging Het
Vmn2r117 T C 17: 23,460,553 N566D probably damaging Het
Wdr12 A T 1: 60,088,072 D141E probably benign Het
Zfp974 A G 7: 27,911,209 S364P probably benign Het
Other mutations in Smarca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Smarca4 APN 9 21679073 missense probably benign 0.30
IGL01694:Smarca4 APN 9 21665870 missense probably damaging 1.00
IGL02147:Smarca4 APN 9 21635703 missense probably damaging 0.98
IGL02417:Smarca4 APN 9 21701090 missense probably damaging 1.00
IGL02421:Smarca4 APN 9 21639239 missense probably damaging 1.00
IGL02550:Smarca4 APN 9 21686122 missense probably benign 0.25
IGL02794:Smarca4 APN 9 21673342 splice site probably benign
IGL03030:Smarca4 APN 9 21635836 missense probably benign 0.14
IGL03037:Smarca4 APN 9 21632935 unclassified probably benign
IGL03069:Smarca4 APN 9 21635836 missense probably benign 0.14
IGL03355:Smarca4 APN 9 21635836 missense probably benign 0.14
R0123:Smarca4 UTSW 9 21637324 missense probably damaging 1.00
R0134:Smarca4 UTSW 9 21637324 missense probably damaging 1.00
R0230:Smarca4 UTSW 9 21700872 missense probably damaging 0.99
R0269:Smarca4 UTSW 9 21636201 missense probably benign 0.09
R0631:Smarca4 UTSW 9 21658984 splice site probably benign
R0665:Smarca4 UTSW 9 21700943 small deletion probably benign
R0726:Smarca4 UTSW 9 21700139 critical splice donor site probably null
R0801:Smarca4 UTSW 9 21642554 missense possibly damaging 0.81
R0918:Smarca4 UTSW 9 21636215 missense probably benign 0.16
R1604:Smarca4 UTSW 9 21700943 small deletion probably benign
R1768:Smarca4 UTSW 9 21701183 missense possibly damaging 0.56
R2004:Smarca4 UTSW 9 21677480 missense probably damaging 1.00
R2031:Smarca4 UTSW 9 21686062 missense possibly damaging 0.68
R2211:Smarca4 UTSW 9 21686029 missense probably damaging 1.00
R2512:Smarca4 UTSW 9 21635698 missense possibly damaging 0.95
R2875:Smarca4 UTSW 9 21642580 missense possibly damaging 0.55
R3786:Smarca4 UTSW 9 21672059 missense possibly damaging 0.94
R4829:Smarca4 UTSW 9 21639327 missense probably damaging 0.97
R5084:Smarca4 UTSW 9 21660763 missense probably damaging 1.00
R5222:Smarca4 UTSW 9 21655706 missense probably benign 0.01
R5785:Smarca4 UTSW 9 21686026 missense probably damaging 0.99
R5844:Smarca4 UTSW 9 21677942 intron probably benign
R5964:Smarca4 UTSW 9 21647430 missense probably benign 0.00
R6001:Smarca4 UTSW 9 21632909 unclassified probably benign
R6072:Smarca4 UTSW 9 21700121 missense probably damaging 1.00
R6254:Smarca4 UTSW 9 21699877 missense probably damaging 1.00
R6320:Smarca4 UTSW 9 21637375 missense probably damaging 1.00
R6353:Smarca4 UTSW 9 21679149 critical splice donor site probably null
R6461:Smarca4 UTSW 9 21679020 missense probably damaging 1.00
R6886:Smarca4 UTSW 9 21658831 missense probably damaging 1.00
R7098:Smarca4 UTSW 9 21634820 missense not run
Predicted Primers PCR Primer
(F):5'- TGTGTCCTCATACAACATGTGCTCC -3'
(R):5'- TTCTGGCAGCCAGCATACTTGAC -3'

Sequencing Primer
(F):5'- ATGTGCTCCCTCCAGGAAC -3'
(R):5'- aaacacctttaatcaggcagac -3'
Posted On2014-05-23