Incidental Mutation 'R1411:Vmn1r199'
ID200818
Institutional Source Beutler Lab
Gene Symbol Vmn1r199
Ensembl Gene ENSMUSG00000069292
Gene Namevomeronasal 1 receptor 199
SynonymsV1rh4
MMRRC Submission 039467-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R1411 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location22379818-22388102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22383501 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 322 (F322L)
Ref Sequence ENSEMBL: ENSMUSP00000153918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091732] [ENSMUST00000227685] [ENSMUST00000227689] [ENSMUST00000227846]
Predicted Effect probably benign
Transcript: ENSMUST00000091732
AA Change: F322L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000089326
Gene: ENSMUSG00000069292
AA Change: F322L

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
Pfam:TAS2R 43 338 3.3e-7 PFAM
Pfam:V1R 75 340 1.6e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120663
Predicted Effect probably benign
Transcript: ENSMUST00000227685
AA Change: F322L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000227689
AA Change: F279L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000227846
AA Change: F279L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.1608 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,730 I85F probably damaging Het
Acp4 A G 7: 44,256,843 probably benign Het
Baz1b T C 5: 135,230,323 F1080L possibly damaging Het
Cbx5 A T 15: 103,213,120 M30K probably benign Het
Cdc73 A G 1: 143,609,514 probably benign Het
Cdcp1 A T 9: 123,190,112 L34Q probably damaging Het
Chd8 C T 14: 52,224,646 V738I probably benign Het
Cpeb2 T G 5: 43,233,770 probably benign Het
Cyp2c67 T A 19: 39,638,591 D265V probably damaging Het
Cyp2j11 A G 4: 96,345,216 I81T probably benign Het
Dbx2 T C 15: 95,632,381 E235G probably damaging Het
Dgkq C A 5: 108,650,362 V677F probably damaging Het
Ercc5 A G 1: 44,178,281 N928S probably damaging Het
Flt1 C T 5: 147,580,316 V1054M probably damaging Het
Flywch1 T C 17: 23,755,824 D614G probably damaging Het
Frmd3 T C 4: 74,153,621 F247L probably damaging Het
Gm1527 A G 3: 28,914,483 N228S probably benign Het
Gm8979 C T 7: 106,083,479 A190T probably benign Het
Gpld1 T A 13: 24,962,808 L251Q probably damaging Het
Gzma C T 13: 113,096,208 V117I probably benign Het
Hydin C A 8: 110,575,031 T3798K probably benign Het
Il1rapl1 T A X: 86,747,298 S679C possibly damaging Het
Lrrc8c G A 5: 105,608,179 A607T probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mfsd4b4 A T 10: 39,892,140 M319K probably damaging Het
Mroh2b A C 15: 4,918,317 H538P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup188 A G 2: 30,343,795 T1733A probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Ofcc1 A G 13: 40,142,787 S524P probably benign Het
Olfr986 C T 9: 40,187,139 T8I possibly damaging Het
Padi4 C T 4: 140,752,603 S413N probably damaging Het
Pdzrn4 A G 15: 92,771,013 *1015W probably null Het
Pkhd1 G A 1: 20,373,896 P2314L probably damaging Het
Serpinb9c C G 13: 33,151,834 V212L probably benign Het
Slc25a23 A G 17: 57,059,622 F18L probably damaging Het
Smarca4 C A 9: 21,658,955 N751K probably damaging Het
Tfip11 G T 5: 112,333,033 V292L probably benign Het
Tnrc18 T C 5: 142,765,947 K1201R unknown Het
Vmn1r201 T C 13: 22,474,679 V21A probably benign Het
Vmn2r108 A T 17: 20,462,845 I699K probably damaging Het
Vmn2r117 T C 17: 23,460,553 N566D probably damaging Het
Wdr12 A T 1: 60,088,072 D141E probably benign Het
Zfp974 A G 7: 27,911,209 S364P probably benign Het
Other mutations in Vmn1r199
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Vmn1r199 APN 13 22382859 missense possibly damaging 0.64
IGL01959:Vmn1r199 APN 13 22383120 missense probably benign 0.07
IGL02270:Vmn1r199 APN 13 22383006 missense probably damaging 1.00
IGL02687:Vmn1r199 APN 13 22382791 missense possibly damaging 0.91
IGL03143:Vmn1r199 APN 13 22383129 missense probably damaging 1.00
R0528:Vmn1r199 UTSW 13 22382566 missense probably benign
R2075:Vmn1r199 UTSW 13 22383265 missense probably damaging 1.00
R5057:Vmn1r199 UTSW 13 22383405 missense possibly damaging 0.93
R5824:Vmn1r199 UTSW 13 22383578 missense probably benign
R5977:Vmn1r199 UTSW 13 22383246 missense probably benign 0.08
R6019:Vmn1r199 UTSW 13 22382599 missense possibly damaging 0.85
R6419:Vmn1r199 UTSW 13 22383607 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GCCAAAGTCTGCATGGCACATC -3'
(R):5'- ACCTCAGTGCAAGGCTTGAATAACC -3'

Sequencing Primer
(F):5'- CATGGTCCTGAGAGATGCAGTC -3'
(R):5'- CAAGGCTTGAATAACCAAGATTATTG -3'
Posted On2014-05-23