Incidental Mutation 'R1411:Gzma'
ID200823
Institutional Source Beutler Lab
Gene Symbol Gzma
Ensembl Gene ENSMUSG00000023132
Gene Namegranzyme A
SynonymsTSP1, Ctla3, H factor, Ctla-3, SE1, serine esterase 1, BLT esterase, TSP-1, Hanukah factor, Hf
MMRRC Submission 039467-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R1411 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location113093825-113100981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 113096208 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 117 (V117I)
Ref Sequence ENSEMBL: ENSMUSP00000023897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023897] [ENSMUST00000224282]
Predicted Effect probably benign
Transcript: ENSMUST00000023897
AA Change: V117I

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000023897
Gene: ENSMUSG00000023132
AA Change: V117I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Tryp_SPc 28 252 1.1e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224282
AA Change: V114I

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.1192 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show normal T/NK cell-mediated cytotoxicity, recovery from LCM virus or L. monocytogenes infection, and control of syngeneic tumor growth. Homozygotes for a different null allele show defective CTL cytolysis and increased tumor burden upon challenge with RMAS cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,730 I85F probably damaging Het
Acp4 A G 7: 44,256,843 probably benign Het
Baz1b T C 5: 135,230,323 F1080L possibly damaging Het
Cbx5 A T 15: 103,213,120 M30K probably benign Het
Cdc73 A G 1: 143,609,514 probably benign Het
Cdcp1 A T 9: 123,190,112 L34Q probably damaging Het
Chd8 C T 14: 52,224,646 V738I probably benign Het
Cpeb2 T G 5: 43,233,770 probably benign Het
Cyp2c67 T A 19: 39,638,591 D265V probably damaging Het
Cyp2j11 A G 4: 96,345,216 I81T probably benign Het
Dbx2 T C 15: 95,632,381 E235G probably damaging Het
Dgkq C A 5: 108,650,362 V677F probably damaging Het
Ercc5 A G 1: 44,178,281 N928S probably damaging Het
Flt1 C T 5: 147,580,316 V1054M probably damaging Het
Flywch1 T C 17: 23,755,824 D614G probably damaging Het
Frmd3 T C 4: 74,153,621 F247L probably damaging Het
Gm1527 A G 3: 28,914,483 N228S probably benign Het
Gm8979 C T 7: 106,083,479 A190T probably benign Het
Gpld1 T A 13: 24,962,808 L251Q probably damaging Het
Hydin C A 8: 110,575,031 T3798K probably benign Het
Il1rapl1 T A X: 86,747,298 S679C possibly damaging Het
Lrrc8c G A 5: 105,608,179 A607T probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mfsd4b4 A T 10: 39,892,140 M319K probably damaging Het
Mroh2b A C 15: 4,918,317 H538P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup188 A G 2: 30,343,795 T1733A probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Ofcc1 A G 13: 40,142,787 S524P probably benign Het
Olfr986 C T 9: 40,187,139 T8I possibly damaging Het
Padi4 C T 4: 140,752,603 S413N probably damaging Het
Pdzrn4 A G 15: 92,771,013 *1015W probably null Het
Pkhd1 G A 1: 20,373,896 P2314L probably damaging Het
Serpinb9c C G 13: 33,151,834 V212L probably benign Het
Slc25a23 A G 17: 57,059,622 F18L probably damaging Het
Smarca4 C A 9: 21,658,955 N751K probably damaging Het
Tfip11 G T 5: 112,333,033 V292L probably benign Het
Tnrc18 T C 5: 142,765,947 K1201R unknown Het
Vmn1r199 T C 13: 22,383,501 F322L probably benign Het
Vmn1r201 T C 13: 22,474,679 V21A probably benign Het
Vmn2r108 A T 17: 20,462,845 I699K probably damaging Het
Vmn2r117 T C 17: 23,460,553 N566D probably damaging Het
Wdr12 A T 1: 60,088,072 D141E probably benign Het
Zfp974 A G 7: 27,911,209 S364P probably benign Het
Other mutations in Gzma
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Gzma APN 13 113093884 utr 3 prime probably benign
R0965:Gzma UTSW 13 113098334 missense probably damaging 1.00
R1597:Gzma UTSW 13 113095797 missense probably damaging 1.00
R1838:Gzma UTSW 13 113095984 missense probably damaging 0.99
R1950:Gzma UTSW 13 113093929 missense probably damaging 1.00
R4153:Gzma UTSW 13 113096268 missense possibly damaging 0.92
R4389:Gzma UTSW 13 113098388 splice site probably null
R5370:Gzma UTSW 13 113095795 missense probably damaging 1.00
R5643:Gzma UTSW 13 113098260 missense probably damaging 1.00
R5644:Gzma UTSW 13 113098260 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATCTGGTTCCTGGTTTCACATC -3'
(R):5'- AGCAGGCACAAGTCTCCATTGAAAG -3'

Sequencing Primer
(F):5'- GTGAAGGATAGCCACATTTCTG -3'
(R):5'- AGCAGGTTTATTCTCTCAAGACACC -3'
Posted On2014-05-23