Incidental Mutation 'R1411:Cbx5'
ID200829
Institutional Source Beutler Lab
Gene Symbol Cbx5
Ensembl Gene ENSMUSG00000009575
Gene Namechromobox 5
Synonymsheterochromatin protein 1 alpha, Hp1a, HP1a, Hp1alpha, 2610029O15Rik, HP1
MMRRC Submission 039467-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1411 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location103191544-103239816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103213120 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 30 (M30K)
Ref Sequence ENSEMBL: ENSMUSP00000120837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108813] [ENSMUST00000118152] [ENSMUST00000122182] [ENSMUST00000127191]
Predicted Effect probably benign
Transcript: ENSMUST00000108813
AA Change: M30K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104441
Gene: ENSMUSG00000009575
AA Change: M30K

DomainStartEndE-ValueType
CHROMO 19 71 1.1e-18 SMART
ChSh 115 177 1.42e-30 SMART
CHROMO 120 172 3.6e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118152
AA Change: M30K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113157
Gene: ENSMUSG00000009575
AA Change: M30K

DomainStartEndE-ValueType
CHROMO 19 71 1.1e-18 SMART
ChSh 115 177 1.42e-30 SMART
CHROMO 120 172 3.6e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122182
AA Change: M30K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113158
Gene: ENSMUSG00000009575
AA Change: M30K

DomainStartEndE-ValueType
CHROMO 19 71 1.1e-18 SMART
ChSh 115 177 1.42e-30 SMART
CHROMO 120 172 3.6e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127191
AA Change: M30K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved nonhistone protein, which is a member of the heterochromatin protein family. The protein is enriched in the heterochromatin and associated with centromeres. The protein has a single N-terminal chromodomain which can bind to histone proteins via methylated lysine residues, and a C-terminal chromo shadow-domain (CSD) which is responsible for the homodimerization and interaction with a number of chromatin-associated nonhistone proteins. The encoded product is involved in the formation of functional kinetochore through interaction with essential kinetochore proteins. The gene has a pseudogene located on chromosome 3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation of this gene are viable and fertile and exhibit no apparent physical or behavioral abnormality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,730 I85F probably damaging Het
Acp4 A G 7: 44,256,843 probably benign Het
Baz1b T C 5: 135,230,323 F1080L possibly damaging Het
Cdc73 A G 1: 143,609,514 probably benign Het
Cdcp1 A T 9: 123,190,112 L34Q probably damaging Het
Chd8 C T 14: 52,224,646 V738I probably benign Het
Cpeb2 T G 5: 43,233,770 probably benign Het
Cyp2c67 T A 19: 39,638,591 D265V probably damaging Het
Cyp2j11 A G 4: 96,345,216 I81T probably benign Het
Dbx2 T C 15: 95,632,381 E235G probably damaging Het
Dgkq C A 5: 108,650,362 V677F probably damaging Het
Ercc5 A G 1: 44,178,281 N928S probably damaging Het
Flt1 C T 5: 147,580,316 V1054M probably damaging Het
Flywch1 T C 17: 23,755,824 D614G probably damaging Het
Frmd3 T C 4: 74,153,621 F247L probably damaging Het
Gm1527 A G 3: 28,914,483 N228S probably benign Het
Gm8979 C T 7: 106,083,479 A190T probably benign Het
Gpld1 T A 13: 24,962,808 L251Q probably damaging Het
Gzma C T 13: 113,096,208 V117I probably benign Het
Hydin C A 8: 110,575,031 T3798K probably benign Het
Il1rapl1 T A X: 86,747,298 S679C possibly damaging Het
Lrrc8c G A 5: 105,608,179 A607T probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mfsd4b4 A T 10: 39,892,140 M319K probably damaging Het
Mroh2b A C 15: 4,918,317 H538P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup188 A G 2: 30,343,795 T1733A probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Ofcc1 A G 13: 40,142,787 S524P probably benign Het
Olfr986 C T 9: 40,187,139 T8I possibly damaging Het
Padi4 C T 4: 140,752,603 S413N probably damaging Het
Pdzrn4 A G 15: 92,771,013 *1015W probably null Het
Pkhd1 G A 1: 20,373,896 P2314L probably damaging Het
Serpinb9c C G 13: 33,151,834 V212L probably benign Het
Slc25a23 A G 17: 57,059,622 F18L probably damaging Het
Smarca4 C A 9: 21,658,955 N751K probably damaging Het
Tfip11 G T 5: 112,333,033 V292L probably benign Het
Tnrc18 T C 5: 142,765,947 K1201R unknown Het
Vmn1r199 T C 13: 22,383,501 F322L probably benign Het
Vmn1r201 T C 13: 22,474,679 V21A probably benign Het
Vmn2r108 A T 17: 20,462,845 I699K probably damaging Het
Vmn2r117 T C 17: 23,460,553 N566D probably damaging Het
Wdr12 A T 1: 60,088,072 D141E probably benign Het
Zfp974 A G 7: 27,911,209 S364P probably benign Het
Other mutations in Cbx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Cbx5 APN 15 103205634 missense probably damaging 0.99
IGL02059:Cbx5 APN 15 103199765 missense probably damaging 0.97
IGL02647:Cbx5 APN 15 103200903 critical splice acceptor site probably null
IGL03143:Cbx5 APN 15 103213105 missense probably damaging 1.00
R0201:Cbx5 UTSW 15 103199700 missense probably damaging 0.98
R1761:Cbx5 UTSW 15 103213180 missense possibly damaging 0.88
R1785:Cbx5 UTSW 15 103213124 missense probably null 0.98
Predicted Primers PCR Primer
(F):5'- GCTCCCAAGACTGTGTTCCCAAC -3'
(R):5'- ACAGAAATGGTCAGGAATAACGCCC -3'

Sequencing Primer
(F):5'- caagactgtgttcccaaccaATTC -3'
(R):5'- CTCTGTTCCATCAAGAAGTGACG -3'
Posted On2014-05-23