Incidental Mutation 'R1411:Flywch1'
ID200832
Institutional Source Beutler Lab
Gene Symbol Flywch1
Ensembl Gene ENSMUSG00000040097
Gene NameFLYWCH-type zinc finger 1
Synonyms
MMRRC Submission 039467-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R1411 (G1)
Quality Score121
Status Validated
Chromosome17
Chromosomal Location23752793-23771602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23755824 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 614 (D614G)
Ref Sequence ENSEMBL: ENSMUSP00000083505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045517] [ENSMUST00000086325]
Predicted Effect probably damaging
Transcript: ENSMUST00000045517
AA Change: D614G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040022
Gene: ENSMUSG00000040097
AA Change: D614G

DomainStartEndE-ValueType
Pfam:FLYWCH_N 1 83 1.2e-24 PFAM
Pfam:FLYWCH 92 150 7e-17 PFAM
Pfam:FLYWCH 235 293 3.3e-17 PFAM
low complexity region 352 380 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
Pfam:FLYWCH 402 460 9.7e-18 PFAM
Pfam:FLYWCH 490 548 7.9e-18 PFAM
Pfam:FLYWCH 581 639 6.1e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086325
AA Change: D614G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083505
Gene: ENSMUSG00000040097
AA Change: D614G

DomainStartEndE-ValueType
Pfam:FLYWCH_N 1 84 9.7e-10 PFAM
Pfam:FLYWCH 92 150 3.8e-17 PFAM
Pfam:FLYWCH 235 293 3.1e-17 PFAM
Pfam:FLYWCH_u 294 401 1.3e-30 PFAM
Pfam:FLYWCH 402 460 9.1e-18 PFAM
Pfam:FLYWCH 490 548 6.8e-18 PFAM
Pfam:FLYWCH_u 549 568 9.1e-3 PFAM
Pfam:FLYWCH 581 639 4.7e-17 PFAM
Pfam:FLYWCH_u 640 672 4.6e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181605
Predicted Effect unknown
Transcript: ENSMUST00000227120
AA Change: D567G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227733
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,730 I85F probably damaging Het
Acp4 A G 7: 44,256,843 probably benign Het
Baz1b T C 5: 135,230,323 F1080L possibly damaging Het
Cbx5 A T 15: 103,213,120 M30K probably benign Het
Cdc73 A G 1: 143,609,514 probably benign Het
Cdcp1 A T 9: 123,190,112 L34Q probably damaging Het
Chd8 C T 14: 52,224,646 V738I probably benign Het
Cpeb2 T G 5: 43,233,770 probably benign Het
Cyp2c67 T A 19: 39,638,591 D265V probably damaging Het
Cyp2j11 A G 4: 96,345,216 I81T probably benign Het
Dbx2 T C 15: 95,632,381 E235G probably damaging Het
Dgkq C A 5: 108,650,362 V677F probably damaging Het
Ercc5 A G 1: 44,178,281 N928S probably damaging Het
Flt1 C T 5: 147,580,316 V1054M probably damaging Het
Frmd3 T C 4: 74,153,621 F247L probably damaging Het
Gm1527 A G 3: 28,914,483 N228S probably benign Het
Gm8979 C T 7: 106,083,479 A190T probably benign Het
Gpld1 T A 13: 24,962,808 L251Q probably damaging Het
Gzma C T 13: 113,096,208 V117I probably benign Het
Hydin C A 8: 110,575,031 T3798K probably benign Het
Il1rapl1 T A X: 86,747,298 S679C possibly damaging Het
Lrrc8c G A 5: 105,608,179 A607T probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mfsd4b4 A T 10: 39,892,140 M319K probably damaging Het
Mroh2b A C 15: 4,918,317 H538P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup188 A G 2: 30,343,795 T1733A probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Ofcc1 A G 13: 40,142,787 S524P probably benign Het
Olfr986 C T 9: 40,187,139 T8I possibly damaging Het
Padi4 C T 4: 140,752,603 S413N probably damaging Het
Pdzrn4 A G 15: 92,771,013 *1015W probably null Het
Pkhd1 G A 1: 20,373,896 P2314L probably damaging Het
Serpinb9c C G 13: 33,151,834 V212L probably benign Het
Slc25a23 A G 17: 57,059,622 F18L probably damaging Het
Smarca4 C A 9: 21,658,955 N751K probably damaging Het
Tfip11 G T 5: 112,333,033 V292L probably benign Het
Tnrc18 T C 5: 142,765,947 K1201R unknown Het
Vmn1r199 T C 13: 22,383,501 F322L probably benign Het
Vmn1r201 T C 13: 22,474,679 V21A probably benign Het
Vmn2r108 A T 17: 20,462,845 I699K probably damaging Het
Vmn2r117 T C 17: 23,460,553 N566D probably damaging Het
Wdr12 A T 1: 60,088,072 D141E probably benign Het
Zfp974 A G 7: 27,911,209 S364P probably benign Het
Other mutations in Flywch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Flywch1 APN 17 23763026 missense probably benign 0.01
IGL01843:Flywch1 APN 17 23760345 missense possibly damaging 0.89
IGL02110:Flywch1 APN 17 23763092 unclassified probably null
IGL02586:Flywch1 APN 17 23755702 missense probably benign 0.04
IGL02870:Flywch1 APN 17 23755902 missense probably damaging 1.00
IGL02877:Flywch1 APN 17 23760414 missense probably damaging 1.00
R0830:Flywch1 UTSW 17 23762370 missense probably benign 0.00
R2044:Flywch1 UTSW 17 23762313 nonsense probably null
R2153:Flywch1 UTSW 17 23755650 missense probably benign 0.21
R2314:Flywch1 UTSW 17 23763026 missense probably benign 0.01
R2497:Flywch1 UTSW 17 23755711 missense probably benign 0.27
R3022:Flywch1 UTSW 17 23763108 missense probably benign 0.00
R3625:Flywch1 UTSW 17 23760201 splice site probably benign
R3691:Flywch1 UTSW 17 23763212 missense probably damaging 0.96
R4805:Flywch1 UTSW 17 23760617 missense probably benign 0.16
R5321:Flywch1 UTSW 17 23756651 missense probably damaging 1.00
R7148:Flywch1 UTSW 17 23755675 missense not run
X0009:Flywch1 UTSW 17 23755655 small deletion probably benign
X0028:Flywch1 UTSW 17 23761095 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGTTAGGCAAAAGCCCTGGTC -3'
(R):5'- AGCAAGCACAGAGTTCGTGGTC -3'

Sequencing Primer
(F):5'- AGCCCTGGTCACTCAGTGTATA -3'
(R):5'- CATGTCTGAGTATTAGTCCCCAGAG -3'
Posted On2014-05-23