Incidental Mutation 'R1392:Hnrnpm'
Institutional Source Beutler Lab
Gene Symbol Hnrnpm
Ensembl Gene ENSMUSG00000059208
Gene Nameheterogeneous nuclear ribonucleoprotein M
SynonymsHnrpm, 2610023M21Rik
MMRRC Submission 039454-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1392 (G1)
Quality Score225
Status Not validated
Chromosomal Location33646233-33686860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33658415 bp
Amino Acid Change Serine to Threonine at position 325 (S325T)
Ref Sequence ENSEMBL: ENSMUSP00000084864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087582] [ENSMUST00000114385] [ENSMUST00000139302] [ENSMUST00000148178]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087582
AA Change: S325T

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000084864
Gene: ENSMUSG00000059208
AA Change: S325T

low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 2.7e-20 PFAM
RRM 71 144 2.35e-20 SMART
RRM 165 237 1.66e-20 SMART
low complexity region 257 274 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 350 356 N/A INTRINSIC
Blast:AAA 430 589 2e-50 BLAST
low complexity region 590 603 N/A INTRINSIC
RRM 614 685 1.51e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114385
AA Change: S364T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000110027
Gene: ENSMUSG00000059208
AA Change: S364T

low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 1.5e-20 PFAM
RRM 71 144 2.35e-20 SMART
low complexity region 164 175 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
RRM 204 276 1.66e-20 SMART
low complexity region 296 313 N/A INTRINSIC
internal_repeat_2 332 432 3.9e-5 PROSPERO
internal_repeat_2 479 581 3.9e-5 PROSPERO
low complexity region 591 602 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
internal_repeat_1 643 676 1.39e-5 PROSPERO
Predicted Effect unknown
Transcript: ENSMUST00000130946
AA Change: S45T
SMART Domains Protein: ENSMUSP00000116671
Gene: ENSMUSG00000059208
AA Change: S45T

low complexity region 28 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139302
AA Change: S325T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000115787
Gene: ENSMUSG00000059208
AA Change: S325T

low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 1.4e-20 PFAM
RRM 71 144 2.35e-20 SMART
RRM 165 237 1.66e-20 SMART
low complexity region 257 274 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 350 356 N/A INTRINSIC
Blast:AAA 430 589 8e-51 BLAST
low complexity region 590 603 N/A INTRINSIC
internal_repeat_1 611 635 5.49e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000148178
AA Change: S364T

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000120115
Gene: ENSMUSG00000059208
AA Change: S364T

low complexity region 2 13 N/A INTRINSIC
Pfam:HnRNP_M 40 69 2.2e-22 PFAM
RRM 71 144 2.35e-20 SMART
low complexity region 164 175 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
RRM 204 276 1.66e-20 SMART
low complexity region 296 313 N/A INTRINSIC
internal_repeat_2 332 432 6.64e-5 PROSPERO
internal_repeat_2 479 581 6.64e-5 PROSPERO
low complexity region 591 602 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
RRM 653 724 1.51e-23 SMART
Predicted Effect unknown
Transcript: ENSMUST00000148258
AA Change: S170T
SMART Domains Protein: ENSMUSP00000123580
Gene: ENSMUSG00000059208
AA Change: S170T

RRM 21 93 1.66e-20 SMART
low complexity region 113 130 N/A INTRINSIC
low complexity region 146 167 N/A INTRINSIC
low complexity region 196 202 N/A INTRINSIC
internal_repeat_1 206 227 9.85e-5 PROSPERO
internal_repeat_1 221 238 9.85e-5 PROSPERO
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 97.1%
  • 10x: 95.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNAs. This protein also constitutes a monomer of the N-acetylglucosamine-specific receptor which is postulated to trigger selective recycling of immature GlcNAc-bearing thyroglobulin molecules. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930005H10Rik T C 3: 115,888,004 probably benign Het
Cenpj T C 14: 56,534,854 probably benign Het
Csf1 A G 3: 107,756,630 V74A probably benign Het
Dsg4 T A 18: 20,446,247 probably benign Het
Hunk T C 16: 90,472,464 S299P probably damaging Het
Kcnk4 C T 19: 6,927,663 V207I possibly damaging Het
Mettl7b T C 10: 128,960,698 T81A possibly damaging Het
Myo15 A G 11: 60,477,974 H520R possibly damaging Het
Nlrp2 A G 7: 5,329,015 probably benign Het
Olfr310 A T 7: 86,268,855 F311L probably benign Het
Olfr351 A T 2: 36,860,175 Y58N probably damaging Het
Phc2 A G 4: 128,745,087 H607R possibly damaging Het
Rsad2 A G 12: 26,445,440 V352A probably benign Het
Rtn4rl2 A G 2: 84,880,512 L136P probably damaging Het
Smc1b T C 15: 85,107,070 probably benign Het
Spef2 C T 15: 9,647,263 V993I probably benign Het
Tiam2 A G 17: 3,414,197 H67R possibly damaging Het
Tmem246 A G 4: 49,586,919 L83P probably damaging Het
Vmn2r65 A T 7: 84,947,416 S144T probably benign Het
Vmn2r77 A G 7: 86,801,622 T239A probably benign Het
Other mutations in Hnrnpm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00869:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00870:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00886:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00898:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00900:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00901:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00905:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00907:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00908:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00911:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00912:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00920:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00921:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00922:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00923:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00924:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00926:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00927:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00928:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00929:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00930:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00931:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00932:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00935:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00938:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00945:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00950:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00952:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00953:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00954:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00955:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00956:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00957:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00958:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00959:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL00960:Hnrnpm APN 17 33649902 missense probably damaging 0.99
IGL01301:Hnrnpm APN 17 33669168 critical splice donor site probably null
IGL02152:Hnrnpm APN 17 33658412 missense probably damaging 1.00
IGL02319:Hnrnpm APN 17 33649950 missense probably damaging 0.98
IGL02487:Hnrnpm APN 17 33648813 missense probably damaging 1.00
IGL03099:Hnrnpm APN 17 33669172 missense probably damaging 1.00
ANU18:Hnrnpm UTSW 17 33669168 critical splice donor site probably null
E0370:Hnrnpm UTSW 17 33658922 splice site probably benign
R0153:Hnrnpm UTSW 17 33646515 missense probably damaging 0.99
R0254:Hnrnpm UTSW 17 33652268 splice site probably null
R0606:Hnrnpm UTSW 17 33658390 missense probably damaging 0.97
R0940:Hnrnpm UTSW 17 33650002 missense probably damaging 1.00
R1216:Hnrnpm UTSW 17 33649713 missense probably damaging 0.99
R1392:Hnrnpm UTSW 17 33658415 missense possibly damaging 0.62
R1454:Hnrnpm UTSW 17 33666488 splice site probably benign
R2011:Hnrnpm UTSW 17 33664624 missense probably damaging 1.00
R4678:Hnrnpm UTSW 17 33650211 missense possibly damaging 0.54
R4926:Hnrnpm UTSW 17 33649801 missense probably damaging 0.97
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ctctctaactagctctgtgacc -3'
Posted On2014-05-23