Incidental Mutation 'R1464:Asic3'
ID200937
Institutional Source Beutler Lab
Gene Symbol Asic3
Ensembl Gene ENSMUSG00000038276
Gene Nameacid-sensing (proton-gated) ion channel 3
SynonymsDRASIC, Accn3
MMRRC Submission 039518-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R1464 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location24413392-24417835 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24413821 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 37 (G37E)
Ref Sequence ENSEMBL: ENSMUSP00000143083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030814] [ENSMUST00000049346] [ENSMUST00000073076] [ENSMUST00000115077] [ENSMUST00000196296]
Predicted Effect probably benign
Transcript: ENSMUST00000030814
SMART Domains Protein: ENSMUSP00000030814
Gene: ENSMUSG00000028969

DomainStartEndE-ValueType
S_TKc 4 286 6.11e-101 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000049346
AA Change: G37E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039914
Gene: ENSMUSG00000038276
AA Change: G37E

DomainStartEndE-ValueType
Pfam:ASC 21 458 2.5e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073076
SMART Domains Protein: ENSMUSP00000072826
Gene: ENSMUSG00000028973

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:ABC_membrane 130 407 3.6e-48 PFAM
AAA 481 668 8.58e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115077
SMART Domains Protein: ENSMUSP00000110729
Gene: ENSMUSG00000028973

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:ABC_membrane 130 407 1.1e-56 PFAM
AAA 481 668 8.58e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136459
Predicted Effect probably benign
Transcript: ENSMUST00000151535
SMART Domains Protein: ENSMUSP00000114767
Gene: ENSMUSG00000028973

DomainStartEndE-ValueType
Pfam:Zeta_toxin 6 68 7.5e-9 PFAM
Pfam:ABC_tran 8 124 1e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196296
AA Change: G37E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143083
Gene: ENSMUSG00000038276
AA Change: G37E

DomainStartEndE-ValueType
Pfam:ASC 21 459 4e-155 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197210
Predicted Effect probably benign
Transcript: ENSMUST00000198166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198241
Predicted Effect probably benign
Transcript: ENSMUST00000198442
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. The members of this family are amiloride-sensitive sodium channels that contain intracellular N and C termini, two hydrophobic transmembrane regions, and a large extracellular loop, which has many cysteine residues with conserved spacing. The member encoded by this gene is an acid sensor and may play an important role in the detection of lasting pH changes. In addition, a heteromeric association between this member and acid-sensing (proton-gated) ion channel 2 has been observed as proton-gated channels sensitive to gadolinium. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced latency to onset of pain responses, increased sensitivity to light touch, but decreased sensitivity to noxious pinch and responses of acid- and noxious heat-sensitive nociceptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,225,403 probably null Het
6030469F06Rik A G 12: 31,184,915 noncoding transcript Het
Abca2 T G 2: 25,447,834 probably benign Het
Adamts8 T A 9: 30,951,377 W86R probably benign Het
Adh1 A G 3: 138,288,747 probably null Het
Adipor2 A T 6: 119,361,843 W150R probably damaging Het
Aff4 T A 11: 53,372,524 S124T probably damaging Het
Ahnak G T 19: 9,004,896 K1181N probably damaging Het
Ak2 C A 4: 129,002,359 probably benign Het
Alkbh5 A G 11: 60,539,047 I209V probably benign Het
Ankrd11 T C 8: 122,892,724 E1442G probably damaging Het
Apba2 T A 7: 64,695,549 D162E probably benign Het
AU040320 A T 4: 126,792,031 K133N possibly damaging Het
C1qtnf7 A G 5: 43,609,139 S34G probably benign Het
Carf A G 1: 60,125,906 probably benign Het
Ccdc148 T A 2: 58,906,362 R463* probably null Het
Ccdc148 T C 2: 58,934,443 R329G probably damaging Het
Ccdc185 A G 1: 182,748,698 I142T probably benign Het
Cd274 T C 19: 29,382,592 probably benign Het
Chrna10 G A 7: 102,114,247 P114S probably damaging Het
Chst10 A G 1: 38,865,691 I311T probably damaging Het
Cpne9 T C 6: 113,294,737 Y353H probably damaging Het
Cubn G T 2: 13,325,288 A2594E possibly damaging Het
Cyp3a13 T C 5: 137,905,565 N277S possibly damaging Het
Dctn4 A G 18: 60,538,406 T117A probably damaging Het
Ddah1 A T 3: 145,853,274 K96* probably null Het
Ddx5 A C 11: 106,784,885 D326E probably benign Het
Dlg2 T C 7: 91,968,198 S323P probably damaging Het
Dnaaf1 C T 8: 119,579,310 H109Y probably damaging Het
Dnah8 C A 17: 30,695,173 R1098S possibly damaging Het
Dnajc13 T C 9: 104,214,167 T642A probably benign Het
Dnajc18 A G 18: 35,680,847 S290P possibly damaging Het
Dscam T A 16: 96,801,253 H663L possibly damaging Het
Eefsec C T 6: 88,376,200 probably benign Het
Emc1 A G 4: 139,370,937 N740S probably damaging Het
Enpp2 C T 15: 54,863,812 G541D probably damaging Het
Fam234b C T 6: 135,228,492 T485I probably benign Het
Fbxl13 A T 5: 21,483,991 I773K probably benign Het
Fmo4 A G 1: 162,794,355 F429S possibly damaging Het
Fndc3b A G 3: 27,440,185 probably benign Het
Frem1 T C 4: 83,011,879 S277G probably damaging Het
Gaa A G 11: 119,272,984 I221V probably benign Het
Gm12794 T A 4: 101,941,306 L158Q probably damaging Het
Gm6614 C T 6: 141,992,517 W225* probably null Het
Gnptab A G 10: 88,445,754 probably benign Het
Gphn T A 12: 78,612,964 probably benign Het
H2afy A T 13: 56,083,136 S310T probably damaging Het
Helz2 T C 2: 181,239,654 E345G probably damaging Het
Ifna4 G T 4: 88,842,000 R47I probably damaging Het
Igsf21 C A 4: 140,034,525 A281S probably benign Het
Ikzf3 T A 11: 98,516,905 I37L probably benign Het
Inpp5d A T 1: 87,698,105 probably benign Het
Jag1 T C 2: 137,115,648 E48G probably damaging Het
Jarid2 G T 13: 44,848,381 V57F probably damaging Het
Kcnj4 A G 15: 79,485,404 L125P probably damaging Het
Kif21b A G 1: 136,156,153 K713E possibly damaging Het
Layn T A 9: 51,057,586 S286C probably damaging Het
Lepr T A 4: 101,735,681 D164E probably benign Het
Map3k1 T C 13: 111,755,871 H950R possibly damaging Het
Map4k5 C A 12: 69,805,350 V801L possibly damaging Het
Mapkbp1 T A 2: 120,021,261 S895T probably benign Het
Mthfr T A 4: 148,053,572 probably benign Het
Naca T A 10: 128,048,288 M2157K probably damaging Het
Nav2 T C 7: 49,362,204 I61T probably damaging Het
Nkx2-5 C A 17: 26,839,279 A234S probably benign Het
Nol8 G A 13: 49,676,788 S1116N probably benign Het
Nphp3 T C 9: 104,031,879 probably benign Het
Nppa T C 4: 148,000,847 S5P probably benign Het
Nup210 A G 6: 91,053,569 V123A possibly damaging Het
Olfr532 G T 7: 140,419,373 N133K probably benign Het
Osbpl11 A G 16: 33,229,085 K604R probably damaging Het
Osbpl1a C T 18: 12,914,558 S113N probably benign Het
P2rx4 C A 5: 122,714,539 P92Q probably damaging Het
Pde9a A T 17: 31,473,162 Q148L probably benign Het
Phf21b T A 15: 84,804,959 H122L probably damaging Het
Pik3ca T A 3: 32,461,841 F977I probably damaging Het
Pkd1l3 A G 8: 109,636,427 probably benign Het
Pp2d1 T G 17: 53,515,987 K17T possibly damaging Het
Ppp4r2 A G 6: 100,866,566 E415G probably damaging Het
Prkg1 A G 19: 30,578,870 S559P probably damaging Het
Prss45 A T 9: 110,840,951 Y276F possibly damaging Het
Ptk7 G T 17: 46,572,591 N849K probably damaging Het
Rnf121 A G 7: 102,031,575 I125T possibly damaging Het
Rnf17 A G 14: 56,461,911 N502S probably damaging Het
Sap25 T A 5: 137,642,360 Y167* probably null Het
Sdk2 G A 11: 113,830,080 T1341I possibly damaging Het
Sgcb A G 5: 73,635,553 V302A probably benign Het
Skor1 T A 9: 63,140,111 M865L possibly damaging Het
Slc25a45 T C 19: 5,879,900 probably benign Het
Slc2a3 A G 6: 122,737,310 probably benign Het
Slc35g1 C A 19: 38,403,217 L316I probably benign Het
Spint4 T A 2: 164,698,648 L33H probably damaging Het
Sptlc3 A T 2: 139,547,234 D178V probably benign Het
Stoml1 A G 9: 58,260,426 probably benign Het
Tbc1d2 T A 4: 46,606,491 Y818F possibly damaging Het
Tbc1d24 A T 17: 24,181,223 probably null Het
Teddm2 C T 1: 153,850,531 W146* probably null Het
Ttn T A 2: 76,758,994 D12948V probably damaging Het
Txndc8 T C 4: 58,000,274 T102A probably damaging Het
Uxs1 G A 1: 43,764,916 Q280* probably null Het
Vmn1r167 T C 7: 23,505,256 T112A possibly damaging Het
Vmn1r195 A T 13: 22,279,178 I273L probably benign Het
Vmn1r28 T A 6: 58,265,232 M20K probably benign Het
Vmn1r53 G A 6: 90,223,932 L137F probably benign Het
Vmn2r105 G A 17: 20,228,742 probably benign Het
Vps13b C T 15: 35,709,484 A1859V probably benign Het
Vwa5b2 A G 16: 20,596,269 H347R probably benign Het
Wnk2 G A 13: 49,081,975 P655S probably damaging Het
Zan T G 5: 137,419,929 D2969A unknown Het
Zbtb24 A G 10: 41,455,079 H334R probably damaging Het
Zfp108 A G 7: 24,260,548 D188G probably benign Het
Zfp784 A T 7: 5,035,801 C253S possibly damaging Het
Zfr T G 15: 12,146,372 C336W probably damaging Het
Other mutations in Asic3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01982:Asic3 APN 5 24417721 missense probably benign 0.44
IGL02527:Asic3 APN 5 24416277 missense probably benign 0.00
IGL02869:Asic3 APN 5 24416974 nonsense probably null
E0370:Asic3 UTSW 5 24413987 missense probably damaging 1.00
IGL03047:Asic3 UTSW 5 24413790 missense probably benign
R0011:Asic3 UTSW 5 24417492 unclassified probably benign
R0011:Asic3 UTSW 5 24417492 unclassified probably benign
R0245:Asic3 UTSW 5 24413838 missense probably damaging 1.00
R0270:Asic3 UTSW 5 24417702 missense probably benign 0.01
R1464:Asic3 UTSW 5 24413821 missense probably damaging 1.00
R1702:Asic3 UTSW 5 24415456 missense probably damaging 1.00
R1824:Asic3 UTSW 5 24413751 nonsense probably null
R3403:Asic3 UTSW 5 24416987 missense probably damaging 1.00
R3722:Asic3 UTSW 5 24416999 missense probably benign 0.08
R4383:Asic3 UTSW 5 24413934 missense probably damaging 1.00
R4573:Asic3 UTSW 5 24417192 missense probably damaging 1.00
R4794:Asic3 UTSW 5 24415897 missense probably damaging 0.96
R6701:Asic3 UTSW 5 24414129 missense possibly damaging 0.65
R7154:Asic3 UTSW 5 24413662 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCTCCTTAGAAATCCCATCCCCAG -3'
(R):5'- GCGTAGAGTTGTGCCATGTCAAAAG -3'

Sequencing Primer
(F):5'- GTCAGGAAACCTCCCTGCTC -3'
(R):5'- CCATGTCAAAAGTCGGACTG -3'
Posted On2014-05-23