Incidental Mutation 'R1464:Ankrd11'
ID200965
Institutional Source Beutler Lab
Gene Symbol Ankrd11
Ensembl Gene ENSMUSG00000035569
Gene Nameankyrin repeat domain 11
Synonyms3010027A04Rik, Yod, 2410104C19Rik, 9530048I21Rik
MMRRC Submission 039518-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1464 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location122883822-123042277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122892724 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1442 (E1442G)
Ref Sequence ENSEMBL: ENSMUSP00000095939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098333] [ENSMUST00000098334] [ENSMUST00000127664] [ENSMUST00000172906]
Predicted Effect probably damaging
Transcript: ENSMUST00000098333
AA Change: E1463G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095938
Gene: ENSMUSG00000035569
AA Change: E1463G

DomainStartEndE-ValueType
ANK 188 217 2.58e-3 SMART
ANK 221 250 1.31e-4 SMART
ANK 254 283 5.04e-6 SMART
low complexity region 311 324 N/A INTRINSIC
low complexity region 366 377 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
low complexity region 470 487 N/A INTRINSIC
low complexity region 499 521 N/A INTRINSIC
low complexity region 534 549 N/A INTRINSIC
low complexity region 596 609 N/A INTRINSIC
low complexity region 649 669 N/A INTRINSIC
coiled coil region 786 826 N/A INTRINSIC
low complexity region 867 877 N/A INTRINSIC
low complexity region 965 984 N/A INTRINSIC
low complexity region 1040 1055 N/A INTRINSIC
low complexity region 1058 1082 N/A INTRINSIC
low complexity region 1187 1200 N/A INTRINSIC
low complexity region 1204 1227 N/A INTRINSIC
low complexity region 1268 1289 N/A INTRINSIC
low complexity region 1294 1306 N/A INTRINSIC
coiled coil region 1374 1406 N/A INTRINSIC
low complexity region 1476 1496 N/A INTRINSIC
low complexity region 1508 1523 N/A INTRINSIC
low complexity region 1526 1547 N/A INTRINSIC
coiled coil region 1598 1625 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1874 1885 N/A INTRINSIC
low complexity region 1913 1922 N/A INTRINSIC
low complexity region 1969 1979 N/A INTRINSIC
low complexity region 2035 2045 N/A INTRINSIC
low complexity region 2057 2071 N/A INTRINSIC
low complexity region 2162 2179 N/A INTRINSIC
low complexity region 2191 2209 N/A INTRINSIC
low complexity region 2224 2236 N/A INTRINSIC
low complexity region 2250 2263 N/A INTRINSIC
low complexity region 2294 2305 N/A INTRINSIC
low complexity region 2391 2409 N/A INTRINSIC
low complexity region 2445 2455 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098334
AA Change: E1442G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095939
Gene: ENSMUSG00000035569
AA Change: E1442G

DomainStartEndE-ValueType
ANK 167 196 2.58e-3 SMART
ANK 200 229 1.31e-4 SMART
ANK 233 262 5.04e-6 SMART
low complexity region 290 303 N/A INTRINSIC
low complexity region 345 356 N/A INTRINSIC
low complexity region 408 419 N/A INTRINSIC
low complexity region 449 466 N/A INTRINSIC
low complexity region 478 500 N/A INTRINSIC
low complexity region 513 528 N/A INTRINSIC
low complexity region 575 588 N/A INTRINSIC
low complexity region 628 648 N/A INTRINSIC
coiled coil region 765 805 N/A INTRINSIC
low complexity region 846 856 N/A INTRINSIC
low complexity region 944 963 N/A INTRINSIC
low complexity region 1019 1034 N/A INTRINSIC
low complexity region 1037 1061 N/A INTRINSIC
low complexity region 1166 1179 N/A INTRINSIC
low complexity region 1183 1206 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1273 1285 N/A INTRINSIC
coiled coil region 1353 1385 N/A INTRINSIC
low complexity region 1455 1475 N/A INTRINSIC
low complexity region 1487 1502 N/A INTRINSIC
low complexity region 1505 1526 N/A INTRINSIC
coiled coil region 1577 1604 N/A INTRINSIC
low complexity region 1749 1760 N/A INTRINSIC
low complexity region 1853 1864 N/A INTRINSIC
low complexity region 1892 1901 N/A INTRINSIC
low complexity region 1948 1958 N/A INTRINSIC
low complexity region 2014 2024 N/A INTRINSIC
low complexity region 2036 2050 N/A INTRINSIC
low complexity region 2141 2158 N/A INTRINSIC
low complexity region 2170 2188 N/A INTRINSIC
low complexity region 2203 2215 N/A INTRINSIC
low complexity region 2229 2242 N/A INTRINSIC
low complexity region 2273 2284 N/A INTRINSIC
low complexity region 2370 2388 N/A INTRINSIC
low complexity region 2424 2434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211940
Predicted Effect probably benign
Transcript: ENSMUST00000212050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212337
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212728
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an ankryin repeat domain-containing protein. The encoded protein inhibits ligand-dependent activation of transcription. Mutations in this gene have been associated with KBG syndrome, which is characterized by macrodontia, distinctive craniofacial features, short stature, skeletal anomalies, global developmental delay, seizures and intellectual disability. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 2 and X. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a spontaneous allele die by E9.5, are small and fail to turn. Mice heterozygous for a spontaneous allele exhibit craniofacial abnormalities, decreased weight, osteoporosis and osteopenia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,225,403 probably null Het
6030469F06Rik A G 12: 31,184,915 noncoding transcript Het
Abca2 T G 2: 25,447,834 probably benign Het
Adamts8 T A 9: 30,951,377 W86R probably benign Het
Adh1 A G 3: 138,288,747 probably null Het
Adipor2 A T 6: 119,361,843 W150R probably damaging Het
Aff4 T A 11: 53,372,524 S124T probably damaging Het
Ahnak G T 19: 9,004,896 K1181N probably damaging Het
Ak2 C A 4: 129,002,359 probably benign Het
Alkbh5 A G 11: 60,539,047 I209V probably benign Het
Apba2 T A 7: 64,695,549 D162E probably benign Het
Asic3 G A 5: 24,413,821 G37E probably damaging Het
AU040320 A T 4: 126,792,031 K133N possibly damaging Het
C1qtnf7 A G 5: 43,609,139 S34G probably benign Het
Carf A G 1: 60,125,906 probably benign Het
Ccdc148 T A 2: 58,906,362 R463* probably null Het
Ccdc148 T C 2: 58,934,443 R329G probably damaging Het
Ccdc185 A G 1: 182,748,698 I142T probably benign Het
Cd274 T C 19: 29,382,592 probably benign Het
Chrna10 G A 7: 102,114,247 P114S probably damaging Het
Chst10 A G 1: 38,865,691 I311T probably damaging Het
Cpne9 T C 6: 113,294,737 Y353H probably damaging Het
Cubn G T 2: 13,325,288 A2594E possibly damaging Het
Cyp3a13 T C 5: 137,905,565 N277S possibly damaging Het
Dctn4 A G 18: 60,538,406 T117A probably damaging Het
Ddah1 A T 3: 145,853,274 K96* probably null Het
Ddx5 A C 11: 106,784,885 D326E probably benign Het
Dlg2 T C 7: 91,968,198 S323P probably damaging Het
Dnaaf1 C T 8: 119,579,310 H109Y probably damaging Het
Dnah8 C A 17: 30,695,173 R1098S possibly damaging Het
Dnajc13 T C 9: 104,214,167 T642A probably benign Het
Dnajc18 A G 18: 35,680,847 S290P possibly damaging Het
Dscam T A 16: 96,801,253 H663L possibly damaging Het
Eefsec C T 6: 88,376,200 probably benign Het
Emc1 A G 4: 139,370,937 N740S probably damaging Het
Enpp2 C T 15: 54,863,812 G541D probably damaging Het
Fam234b C T 6: 135,228,492 T485I probably benign Het
Fbxl13 A T 5: 21,483,991 I773K probably benign Het
Fmo4 A G 1: 162,794,355 F429S possibly damaging Het
Fndc3b A G 3: 27,440,185 probably benign Het
Frem1 T C 4: 83,011,879 S277G probably damaging Het
Gaa A G 11: 119,272,984 I221V probably benign Het
Gm12794 T A 4: 101,941,306 L158Q probably damaging Het
Gm6614 C T 6: 141,992,517 W225* probably null Het
Gnptab A G 10: 88,445,754 probably benign Het
Gphn T A 12: 78,612,964 probably benign Het
H2afy A T 13: 56,083,136 S310T probably damaging Het
Helz2 T C 2: 181,239,654 E345G probably damaging Het
Ifna4 G T 4: 88,842,000 R47I probably damaging Het
Igsf21 C A 4: 140,034,525 A281S probably benign Het
Ikzf3 T A 11: 98,516,905 I37L probably benign Het
Inpp5d A T 1: 87,698,105 probably benign Het
Jag1 T C 2: 137,115,648 E48G probably damaging Het
Jarid2 G T 13: 44,848,381 V57F probably damaging Het
Kcnj4 A G 15: 79,485,404 L125P probably damaging Het
Kif21b A G 1: 136,156,153 K713E possibly damaging Het
Layn T A 9: 51,057,586 S286C probably damaging Het
Lepr T A 4: 101,735,681 D164E probably benign Het
Map3k1 T C 13: 111,755,871 H950R possibly damaging Het
Map4k5 C A 12: 69,805,350 V801L possibly damaging Het
Mapkbp1 T A 2: 120,021,261 S895T probably benign Het
Mthfr T A 4: 148,053,572 probably benign Het
Naca T A 10: 128,048,288 M2157K probably damaging Het
Nav2 T C 7: 49,362,204 I61T probably damaging Het
Nkx2-5 C A 17: 26,839,279 A234S probably benign Het
Nol8 G A 13: 49,676,788 S1116N probably benign Het
Nphp3 T C 9: 104,031,879 probably benign Het
Nppa T C 4: 148,000,847 S5P probably benign Het
Nup210 A G 6: 91,053,569 V123A possibly damaging Het
Olfr532 G T 7: 140,419,373 N133K probably benign Het
Osbpl11 A G 16: 33,229,085 K604R probably damaging Het
Osbpl1a C T 18: 12,914,558 S113N probably benign Het
P2rx4 C A 5: 122,714,539 P92Q probably damaging Het
Pde9a A T 17: 31,473,162 Q148L probably benign Het
Phf21b T A 15: 84,804,959 H122L probably damaging Het
Pik3ca T A 3: 32,461,841 F977I probably damaging Het
Pkd1l3 A G 8: 109,636,427 probably benign Het
Pp2d1 T G 17: 53,515,987 K17T possibly damaging Het
Ppp4r2 A G 6: 100,866,566 E415G probably damaging Het
Prkg1 A G 19: 30,578,870 S559P probably damaging Het
Prss45 A T 9: 110,840,951 Y276F possibly damaging Het
Ptk7 G T 17: 46,572,591 N849K probably damaging Het
Rnf121 A G 7: 102,031,575 I125T possibly damaging Het
Rnf17 A G 14: 56,461,911 N502S probably damaging Het
Sap25 T A 5: 137,642,360 Y167* probably null Het
Sdk2 G A 11: 113,830,080 T1341I possibly damaging Het
Sgcb A G 5: 73,635,553 V302A probably benign Het
Skor1 T A 9: 63,140,111 M865L possibly damaging Het
Slc25a45 T C 19: 5,879,900 probably benign Het
Slc2a3 A G 6: 122,737,310 probably benign Het
Slc35g1 C A 19: 38,403,217 L316I probably benign Het
Spint4 T A 2: 164,698,648 L33H probably damaging Het
Sptlc3 A T 2: 139,547,234 D178V probably benign Het
Stoml1 A G 9: 58,260,426 probably benign Het
Tbc1d2 T A 4: 46,606,491 Y818F possibly damaging Het
Tbc1d24 A T 17: 24,181,223 probably null Het
Teddm2 C T 1: 153,850,531 W146* probably null Het
Ttn T A 2: 76,758,994 D12948V probably damaging Het
Txndc8 T C 4: 58,000,274 T102A probably damaging Het
Uxs1 G A 1: 43,764,916 Q280* probably null Het
Vmn1r167 T C 7: 23,505,256 T112A possibly damaging Het
Vmn1r195 A T 13: 22,279,178 I273L probably benign Het
Vmn1r28 T A 6: 58,265,232 M20K probably benign Het
Vmn1r53 G A 6: 90,223,932 L137F probably benign Het
Vmn2r105 G A 17: 20,228,742 probably benign Het
Vps13b C T 15: 35,709,484 A1859V probably benign Het
Vwa5b2 A G 16: 20,596,269 H347R probably benign Het
Wnk2 G A 13: 49,081,975 P655S probably damaging Het
Zan T G 5: 137,419,929 D2969A unknown Het
Zbtb24 A G 10: 41,455,079 H334R probably damaging Het
Zfp108 A G 7: 24,260,548 D188G probably benign Het
Zfp784 A T 7: 5,035,801 C253S possibly damaging Het
Zfr T G 15: 12,146,372 C336W probably damaging Het
Other mutations in Ankrd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Ankrd11 APN 8 122908728 missense possibly damaging 0.59
IGL00971:Ankrd11 APN 8 122895353 missense probably damaging 1.00
IGL01017:Ankrd11 APN 8 122894728 missense probably damaging 1.00
IGL01137:Ankrd11 APN 8 122884336 missense probably damaging 0.99
IGL01659:Ankrd11 APN 8 122895371 missense probably damaging 1.00
IGL01920:Ankrd11 APN 8 122915897 splice site probably benign
IGL01964:Ankrd11 APN 8 122889736 missense probably damaging 0.97
IGL02131:Ankrd11 APN 8 122894410 missense probably damaging 1.00
IGL02226:Ankrd11 APN 8 122892245 missense probably damaging 1.00
IGL02549:Ankrd11 APN 8 122891293 missense probably damaging 1.00
IGL02642:Ankrd11 APN 8 122890651 missense probably damaging 1.00
IGL02643:Ankrd11 APN 8 122892322 missense probably damaging 0.98
IGL02861:Ankrd11 APN 8 122895827 missense probably damaging 0.99
IGL03086:Ankrd11 APN 8 122894510 missense probably damaging 1.00
IGL03336:Ankrd11 APN 8 122891843 missense probably benign 0.00
anchors UTSW 8 122895770 missense probably damaging 0.99
away UTSW 8 122891953 missense probably damaging 1.00
bluebell UTSW 8 122891785 missense probably damaging 0.97
navy UTSW 8 122908734 nonsense probably null
R0051:Ankrd11 UTSW 8 122889742 missense probably damaging 1.00
R0051:Ankrd11 UTSW 8 122889742 missense probably damaging 1.00
R0110:Ankrd11 UTSW 8 122892175 missense possibly damaging 0.95
R0281:Ankrd11 UTSW 8 122895568 missense probably benign 0.01
R0450:Ankrd11 UTSW 8 122892175 missense possibly damaging 0.95
R0481:Ankrd11 UTSW 8 122900036 missense probably damaging 1.00
R0542:Ankrd11 UTSW 8 122895770 missense probably damaging 0.99
R0606:Ankrd11 UTSW 8 122892832 missense probably benign 0.04
R0702:Ankrd11 UTSW 8 122889766 missense probably damaging 1.00
R0730:Ankrd11 UTSW 8 122891953 missense probably damaging 1.00
R0737:Ankrd11 UTSW 8 122895836 missense probably damaging 0.99
R1401:Ankrd11 UTSW 8 122893050 missense probably benign 0.23
R1464:Ankrd11 UTSW 8 122892724 missense probably damaging 1.00
R1470:Ankrd11 UTSW 8 122899724 missense probably damaging 0.98
R1470:Ankrd11 UTSW 8 122899724 missense probably damaging 0.98
R1641:Ankrd11 UTSW 8 122891746 missense probably benign 0.03
R1950:Ankrd11 UTSW 8 122889869 missense probably damaging 1.00
R2004:Ankrd11 UTSW 8 122902422 critical splice donor site probably null
R2401:Ankrd11 UTSW 8 122908734 nonsense probably null
R2425:Ankrd11 UTSW 8 122893163 missense possibly damaging 0.86
R2830:Ankrd11 UTSW 8 122892196 missense probably damaging 1.00
R2910:Ankrd11 UTSW 8 122908798 missense probably damaging 1.00
R2911:Ankrd11 UTSW 8 122908798 missense probably damaging 1.00
R3736:Ankrd11 UTSW 8 122891785 missense probably damaging 0.97
R3738:Ankrd11 UTSW 8 122896715 unclassified probably benign
R3739:Ankrd11 UTSW 8 122896715 unclassified probably benign
R3813:Ankrd11 UTSW 8 122891378 missense probably benign
R4012:Ankrd11 UTSW 8 122892417 missense probably damaging 0.98
R4183:Ankrd11 UTSW 8 122899676 missense possibly damaging 0.88
R4213:Ankrd11 UTSW 8 122891026 missense probably benign 0.00
R4469:Ankrd11 UTSW 8 122896587 missense probably damaging 1.00
R4482:Ankrd11 UTSW 8 122893489 missense probably damaging 1.00
R4935:Ankrd11 UTSW 8 122900183 missense probably benign 0.02
R4940:Ankrd11 UTSW 8 122889821 missense probably damaging 1.00
R5145:Ankrd11 UTSW 8 122891204 utr 3 prime probably benign
R5154:Ankrd11 UTSW 8 122893139 missense probably damaging 1.00
R5230:Ankrd11 UTSW 8 122890477 missense probably benign 0.11
R5283:Ankrd11 UTSW 8 122884182 missense probably damaging 1.00
R5377:Ankrd11 UTSW 8 122893714 unclassified probably null
R5513:Ankrd11 UTSW 8 122892520 missense probably benign 0.38
R5518:Ankrd11 UTSW 8 122890994 missense possibly damaging 0.93
R5549:Ankrd11 UTSW 8 122890378 missense probably benign 0.02
R5579:Ankrd11 UTSW 8 122884231 missense probably damaging 0.97
R5595:Ankrd11 UTSW 8 122894304 nonsense probably null
R5650:Ankrd11 UTSW 8 122887397 missense probably damaging 0.99
R5717:Ankrd11 UTSW 8 122892638 missense possibly damaging 0.92
R5753:Ankrd11 UTSW 8 122895304 missense possibly damaging 0.90
R5782:Ankrd11 UTSW 8 122900017 missense probably damaging 1.00
R5812:Ankrd11 UTSW 8 122893805 unclassified probably null
R5823:Ankrd11 UTSW 8 122895790 missense probably benign 0.12
R5900:Ankrd11 UTSW 8 122891066 missense probably benign 0.00
R5975:Ankrd11 UTSW 8 122889749 missense possibly damaging 0.93
R5979:Ankrd11 UTSW 8 122892400 missense probably damaging 1.00
R6000:Ankrd11 UTSW 8 122891195 missense possibly damaging 0.73
R6145:Ankrd11 UTSW 8 122892661 missense probably damaging 1.00
R6252:Ankrd11 UTSW 8 122893822 missense possibly damaging 0.87
R6302:Ankrd11 UTSW 8 122889989 missense probably benign
R6457:Ankrd11 UTSW 8 122908764 missense probably damaging 1.00
R6513:Ankrd11 UTSW 8 122890180 missense probably benign 0.02
R6582:Ankrd11 UTSW 8 122891629 missense probably benign 0.00
R6738:Ankrd11 UTSW 8 122891921 missense probably damaging 0.99
R6865:Ankrd11 UTSW 8 122894944 missense probably benign 0.41
R6913:Ankrd11 UTSW 8 122894911 missense probably benign 0.01
R7101:Ankrd11 UTSW 8 122895455 missense probably benign 0.35
R7116:Ankrd11 UTSW 8 122896130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCATCATGAGGTCGCCATCTCC -3'
(R):5'- CCAGCCAGTTCGAGAAAGACTTCC -3'

Sequencing Primer
(F):5'- GAGTCTCTGGATGGCACAAG -3'
(R):5'- GACTTCCTGGATGCAGAGACTTAC -3'
Posted On2014-05-23