Incidental Mutation 'R1465:Col4a4'
ID201020
Institutional Source Beutler Lab
Gene Symbol Col4a4
Ensembl Gene ENSMUSG00000067158
Gene Namecollagen, type IV, alpha 4
SynonymsE130010M05Rik, [a]4(IV)
MMRRC Submission 039519-MU
Accession Numbers

Genbank: NM_007735; MGI: 104687

Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R1465 (G1)
Quality Score216
Status Not validated
Chromosome1
Chromosomal Location82448423-82586849 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to T at 82497822 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000084282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087050]
Predicted Effect probably null
Transcript: ENSMUST00000087050
SMART Domains Protein: ENSMUSP00000084282
Gene: ENSMUSG00000067158

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
Pfam:Collagen 54 113 4e-11 PFAM
Pfam:Collagen 110 168 4.1e-10 PFAM
Pfam:Collagen 172 229 2.8e-10 PFAM
low complexity region 265 288 N/A INTRINSIC
internal_repeat_7 289 345 1.46e-9 PROSPERO
internal_repeat_6 291 348 5.03e-10 PROSPERO
internal_repeat_9 297 353 7.22e-9 PROSPERO
internal_repeat_4 322 354 2.06e-11 PROSPERO
internal_repeat_11 334 349 1.25e-5 PROSPERO
Pfam:Collagen 392 449 1.3e-8 PFAM
low complexity region 461 482 N/A INTRINSIC
Pfam:Collagen 486 553 1e-10 PFAM
low complexity region 563 595 N/A INTRINSIC
Pfam:Collagen 597 658 1e-8 PFAM
Pfam:Collagen 663 731 4.4e-10 PFAM
Pfam:Collagen 755 810 3.3e-9 PFAM
internal_repeat_2 816 841 2.9e-13 PROSPERO
Pfam:Collagen 844 912 1.8e-10 PFAM
Pfam:Collagen 898 962 2.7e-10 PFAM
low complexity region 963 1003 N/A INTRINSIC
Pfam:Collagen 1006 1071 2e-10 PFAM
Pfam:Collagen 1073 1132 5.8e-12 PFAM
Pfam:Collagen 1124 1185 1.8e-10 PFAM
Pfam:Collagen 1187 1245 2.3e-8 PFAM
low complexity region 1277 1361 N/A INTRINSIC
low complexity region 1371 1384 N/A INTRINSIC
Pfam:Collagen 1395 1454 4.3e-8 PFAM
C4 1457 1564 3.36e-58 SMART
C4 1565 1681 1.49e-59 SMART
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.5%
  • 10x: 93.6%
  • 20x: 86.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. This particular collagen IV subunit, however, is only found in a subset of basement membranes. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Mutations in this gene are associated with type II autosomal recessive Alport syndrome (hereditary glomerulonephropathy) and with familial benign hematuria (thin basement membrane disease). Two transcripts, differing only in their transcription start sites, have been identified for this gene and, as is common for collagen genes, multiple polyadenylation sites are found in the 3' UTR. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced mutation develop an early nephritic syndrome associated with uremia, proteinuria, hematuria, leukocyturia, and focal segmental glomerulosclerosis, and die prematurely of kidney failure. Some homozygotes exhibit moderatesensorineural hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,740,566 Y121H probably damaging Het
Abca13 G T 11: 9,399,303 G3626W probably damaging Het
Acvr1c A G 2: 58,284,961 Y192H probably damaging Het
Afm A T 5: 90,550,341 D534V probably damaging Het
Agl T C 3: 116,771,372 E1076G probably benign Het
Angptl3 A T 4: 99,037,520 H361L probably benign Het
Apob T C 12: 8,011,421 F3301S possibly damaging Het
Arhgef33 T A 17: 80,367,301 C376S possibly damaging Het
Ass1 A G 2: 31,520,416 *413W probably null Het
Atp6v1h T A 1: 5,095,688 L127Q probably damaging Het
Bcl2l1 G A 2: 152,829,950 S14F probably damaging Het
Birc6 G A 17: 74,623,858 A2477T probably benign Het
Bpifb9a G A 2: 154,271,021 A589T possibly damaging Het
Casp9 C A 4: 141,805,840 T252K probably benign Het
Cct4 G A 11: 23,002,922 D533N probably damaging Het
Clcn6 A C 4: 148,013,901 I555S probably damaging Het
Cyp2d10 A T 15: 82,403,928 probably null Het
D930048N14Rik A G 11: 51,654,913 probably benign Het
Dhfr A G 13: 92,368,307 probably benign Het
Dlg5 T C 14: 24,154,696 probably null Het
Dnah11 T C 12: 118,038,695 E2240G probably damaging Het
Dnmt3a A G 12: 3,866,088 E17G probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Dpy19l2 A G 9: 24,669,322 M241T probably benign Het
Dpy19l4 A G 4: 11,296,034 S212P probably damaging Het
Ephb6 T C 6: 41,616,106 F426S probably damaging Het
F5 A T 1: 164,198,833 D1658V probably benign Het
Faah A T 4: 115,999,558 V469E probably damaging Het
Fas T C 19: 34,316,613 C123R probably damaging Het
Fhod1 T C 8: 105,338,914 probably benign Het
Filip1 A G 9: 79,898,307 V55A probably benign Het
Frmpd1 G A 4: 45,273,197 R372Q probably damaging Het
Glyctk C T 9: 106,157,607 G87S probably damaging Het
Gm4737 T C 16: 46,153,848 K389E probably benign Het
Gm5096 T G 18: 87,757,258 F302V probably damaging Het
Golga3 T C 5: 110,209,878 L1080P probably damaging Het
Gpr137 T C 19: 6,938,444 T281A probably benign Het
Grap2 T A 15: 80,648,411 probably null Het
Hlcs T C 16: 94,268,292 D170G probably damaging Het
Hook1 A G 4: 96,013,256 T484A probably benign Het
Hoxa5 T A 6: 52,203,791 H187L probably benign Het
Inpp1 G T 1: 52,790,094 S255R probably benign Het
Inpp4b T A 8: 81,768,157 V67E probably damaging Het
Iqgap3 A G 3: 88,087,309 N105S probably damaging Het
Kcnq5 A G 1: 21,469,468 probably null Het
Klhl1 T C 14: 96,240,213 N473S probably benign Het
Klk1b24 C A 7: 44,191,361 T71N probably benign Het
Loxhd1 A G 18: 77,380,573 probably null Het
Lrp1b C T 2: 41,111,059 R2165Q probably benign Het
Lrp2bp A T 8: 46,025,235 Q328L possibly damaging Het
Lrrc63 T A 14: 75,107,389 K419N possibly damaging Het
Lrrc9 A G 12: 72,500,759 N150S probably benign Het
Lrrn4 C A 2: 132,872,075 C317F probably damaging Het
Ltbp2 T C 12: 84,813,300 S627G probably damaging Het
Macf1 A T 4: 123,493,154 S1224T probably damaging Het
Meis2 A C 2: 116,058,670 H200Q probably benign Het
Mesd C A 7: 83,895,582 A80E probably benign Het
Mtor G T 4: 148,525,993 probably benign Het
Myo3a T C 2: 22,577,927 F398L probably benign Het
Nagpa G T 16: 5,201,528 probably benign Het
Nanp A G 2: 151,030,829 C60R probably benign Het
Nectin2 T G 7: 19,730,116 M313L probably benign Het
Nek4 C T 14: 30,956,887 H123Y probably damaging Het
Nploc4 A G 11: 120,408,781 V371A probably damaging Het
Ntrk3 T C 7: 78,356,014 probably benign Het
Olfr1463 T A 19: 13,234,901 V217E possibly damaging Het
Olfr156 A G 4: 43,820,723 F213L probably benign Het
Olfr658 T C 7: 104,644,946 N140S probably benign Het
Olfr740 A G 14: 50,453,177 T42A possibly damaging Het
Pcdh20 T A 14: 88,469,237 Q209L probably benign Het
Pcdhb20 G A 18: 37,504,697 R92H probably damaging Het
Pgap1 T C 1: 54,528,555 H377R probably benign Het
Phyhipl G T 10: 70,570,968 P52Q probably damaging Het
Plekhg4 T C 8: 105,381,040 probably benign Het
Pwwp2a T A 11: 43,705,556 V516E possibly damaging Het
Rack1 T C 11: 48,801,759 V69A probably damaging Het
Rexo5 T A 7: 119,801,358 probably null Het
Rnf123 T C 9: 108,071,466 probably benign Het
Rock1 G T 18: 10,072,863 Q1161K possibly damaging Het
Rps6ka2 T C 17: 7,292,867 L568P probably damaging Het
Seh1l T C 18: 67,783,984 S78P probably damaging Het
Serpinb3b A T 1: 107,155,843 probably null Het
Setd1a T C 7: 127,788,340 probably benign Het
Setx G T 2: 29,140,389 probably null Het
Sh3bp1 T C 15: 78,907,345 probably benign Het
Shc2 G T 10: 79,631,302 R146S probably damaging Het
Skap2 T C 6: 51,909,368 T5A probably benign Het
Skor2 A T 18: 76,876,645 probably benign Het
Slc35a3 T C 3: 116,687,334 I93M probably benign Het
Sohlh1 C T 2: 25,843,347 G295D probably damaging Het
Speg A G 1: 75,428,484 probably benign Het
Sult2a8 A C 7: 14,416,283 C168G probably benign Het
Tax1bp1 T C 6: 52,727,194 probably benign Het
Tbc1d4 T C 14: 101,447,688 I1176V possibly damaging Het
Tcof1 A G 18: 60,818,954 probably benign Het
Thada A T 17: 84,436,676 F735I possibly damaging Het
Tle1 A C 4: 72,139,831 H52Q probably damaging Het
Tmem101 A T 11: 102,153,329 V244E probably damaging Het
Tnfrsf26 C A 7: 143,617,931 C95F probably damaging Het
Uspl1 T C 5: 149,214,032 S482P probably benign Het
Vmn2r118 G T 17: 55,610,935 N192K probably benign Het
Vmn2r14 C T 5: 109,220,329 V266I possibly damaging Het
Vmn2r51 A G 7: 10,100,322 I263T probably damaging Het
Zfp937 T A 2: 150,239,047 C332* probably null Het
Zscan21 T A 5: 138,125,208 S50T probably benign Het
Other mutations in Col4a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Col4a4 APN 1 82491641 missense unknown
IGL01092:Col4a4 APN 1 82466545 missense unknown
IGL01104:Col4a4 APN 1 82466545 missense unknown
IGL01413:Col4a4 APN 1 82471248 missense unknown
IGL01518:Col4a4 APN 1 82455759 missense unknown
IGL02014:Col4a4 APN 1 82523960 splice site probably benign
IGL02215:Col4a4 APN 1 82453809 missense unknown
IGL02707:Col4a4 APN 1 82493516 missense unknown
IGL02858:Col4a4 APN 1 82528483 missense unknown
IGL02987:Col4a4 APN 1 82498925 splice site probably benign
IGL03384:Col4a4 APN 1 82484438 missense probably benign 0.04
aoba UTSW 1 82535740 critical splice donor site probably benign
IGL02980:Col4a4 UTSW 1 82469477 critical splice donor site probably null
R0028:Col4a4 UTSW 1 82487510 critical splice donor site probably null
R0083:Col4a4 UTSW 1 82507111 critical splice acceptor site probably null
R0696:Col4a4 UTSW 1 82492549 missense unknown
R0788:Col4a4 UTSW 1 82524996 missense unknown
R0789:Col4a4 UTSW 1 82524996 missense unknown
R0790:Col4a4 UTSW 1 82524996 missense unknown
R0894:Col4a4 UTSW 1 82529656 splice site probably null
R1217:Col4a4 UTSW 1 82489009 critical splice donor site probably null
R1465:Col4a4 UTSW 1 82497822 splice site probably null
R1474:Col4a4 UTSW 1 82480486 nonsense probably null
R1508:Col4a4 UTSW 1 82455836 missense unknown
R1640:Col4a4 UTSW 1 82535770 missense unknown
R1678:Col4a4 UTSW 1 82486659 missense unknown
R1827:Col4a4 UTSW 1 82539988 missense unknown
R1930:Col4a4 UTSW 1 82466600 splice site probably null
R1931:Col4a4 UTSW 1 82466600 splice site probably null
R2092:Col4a4 UTSW 1 82498946 missense unknown
R2122:Col4a4 UTSW 1 82456871 missense unknown
R2132:Col4a4 UTSW 1 82497860 missense unknown
R2396:Col4a4 UTSW 1 82507072 missense unknown
R2418:Col4a4 UTSW 1 82532936 missense unknown
R2679:Col4a4 UTSW 1 82529611 missense unknown
R3085:Col4a4 UTSW 1 82529564 critical splice donor site probably null
R3437:Col4a4 UTSW 1 82497168 missense unknown
R3697:Col4a4 UTSW 1 82541237 missense unknown
R3730:Col4a4 UTSW 1 82455751 synonymous probably null
R3752:Col4a4 UTSW 1 82480494 missense probably damaging 0.97
R4085:Col4a4 UTSW 1 82471188 critical splice donor site probably null
R4087:Col4a4 UTSW 1 82523922 missense unknown
R4088:Col4a4 UTSW 1 82523922 missense unknown
R4090:Col4a4 UTSW 1 82523922 missense unknown
R4213:Col4a4 UTSW 1 82453144 missense unknown
R4422:Col4a4 UTSW 1 82489838 missense unknown
R4596:Col4a4 UTSW 1 82471219 missense unknown
R4755:Col4a4 UTSW 1 82541174 missense unknown
R4757:Col4a4 UTSW 1 82528466 missense unknown
R4793:Col4a4 UTSW 1 82539099 missense unknown
R4812:Col4a4 UTSW 1 82462153 missense unknown
R4833:Col4a4 UTSW 1 82529602 missense unknown
R5259:Col4a4 UTSW 1 82453893 missense unknown
R5264:Col4a4 UTSW 1 82493591 missense unknown
R5265:Col4a4 UTSW 1 82493591 missense unknown
R5281:Col4a4 UTSW 1 82493591 missense unknown
R5283:Col4a4 UTSW 1 82493591 missense unknown
R5284:Col4a4 UTSW 1 82493591 missense unknown
R5387:Col4a4 UTSW 1 82493591 missense unknown
R5388:Col4a4 UTSW 1 82493591 missense unknown
R5435:Col4a4 UTSW 1 82454007 missense unknown
R5534:Col4a4 UTSW 1 82487517 missense unknown
R5666:Col4a4 UTSW 1 82485579 critical splice donor site probably null
R5670:Col4a4 UTSW 1 82485579 critical splice donor site probably null
R5943:Col4a4 UTSW 1 82525016 missense unknown
R5996:Col4a4 UTSW 1 82455728 missense unknown
R5999:Col4a4 UTSW 1 82492619 missense unknown
R6112:Col4a4 UTSW 1 82453883 missense unknown
R6192:Col4a4 UTSW 1 82484430 missense probably damaging 1.00
R6237:Col4a4 UTSW 1 82507031 missense unknown
R6419:Col4a4 UTSW 1 82466486 critical splice donor site probably null
R6458:Col4a4 UTSW 1 82455825 missense unknown
R6460:Col4a4 UTSW 1 82466532 missense unknown
R6481:Col4a4 UTSW 1 82453778 missense unknown
R6522:Col4a4 UTSW 1 82487583 missense unknown
X0020:Col4a4 UTSW 1 82539952 critical splice donor site probably null
Z1088:Col4a4 UTSW 1 82453196 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCCTTAGGAGAAGGTATCCAGCC -3'
(R):5'- GAGTCACTCAGGAATCTCAGCCAAC -3'

Sequencing Primer
(F):5'- AGGTATCCAGCCAGATAGGCTC -3'
(R):5'- TCTCAGCCAACCTTCATAGAGTG -3'
Posted On2014-05-23