Incidental Mutation 'R1465:Ass1'
ID201026
Institutional Source Beutler Lab
Gene Symbol Ass1
Ensembl Gene ENSMUSG00000076441
Gene Nameargininosuccinate synthetase 1
SynonymsAss-1, ASS, fold
MMRRC Submission 039519-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1465 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location31470207-31520672 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 31520416 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 413 (*413W)
Ref Sequence ENSEMBL: ENSMUSP00000099904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102840]
Predicted Effect probably null
Transcript: ENSMUST00000102840
AA Change: *413W
SMART Domains Protein: ENSMUSP00000099904
Gene: ENSMUSG00000076441
AA Change: *413W

DomainStartEndE-ValueType
Pfam:QueC 6 93 2.8e-7 PFAM
Pfam:Arginosuc_synth 8 403 1.9e-177 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130195
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.5%
  • 10x: 93.6%
  • 20x: 86.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the penultimate step of the arginine biosynthetic pathway. There are approximately 10 to 14 copies of this gene including the pseudogenes scattered across the human genome, among which the one located on chromosome 9 appears to be the only functional gene for argininosuccinate synthetase. Mutations in the chromosome 9 copy of this gene cause citrullinemia. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Targeted disruption of this gene results in high levels of blood citrulline, hyperammonemia, and death by 24 hours after birth. Some spontaneous mutations display wrinkled skin, sparse hair with delayed hair appearance and abnormal hair follicle morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,740,566 Y121H probably damaging Het
Abca13 G T 11: 9,399,303 G3626W probably damaging Het
Acvr1c A G 2: 58,284,961 Y192H probably damaging Het
Afm A T 5: 90,550,341 D534V probably damaging Het
Agl T C 3: 116,771,372 E1076G probably benign Het
Angptl3 A T 4: 99,037,520 H361L probably benign Het
Apob T C 12: 8,011,421 F3301S possibly damaging Het
Arhgef33 T A 17: 80,367,301 C376S possibly damaging Het
Atp6v1h T A 1: 5,095,688 L127Q probably damaging Het
Bcl2l1 G A 2: 152,829,950 S14F probably damaging Het
Birc6 G A 17: 74,623,858 A2477T probably benign Het
Bpifb9a G A 2: 154,271,021 A589T possibly damaging Het
Casp9 C A 4: 141,805,840 T252K probably benign Het
Cct4 G A 11: 23,002,922 D533N probably damaging Het
Clcn6 A C 4: 148,013,901 I555S probably damaging Het
Col4a4 A T 1: 82,497,822 probably null Het
Cyp2d10 A T 15: 82,403,928 probably null Het
D930048N14Rik A G 11: 51,654,913 probably benign Het
Dhfr A G 13: 92,368,307 probably benign Het
Dlg5 T C 14: 24,154,696 probably null Het
Dnah11 T C 12: 118,038,695 E2240G probably damaging Het
Dnmt3a A G 12: 3,866,088 E17G probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Dpy19l2 A G 9: 24,669,322 M241T probably benign Het
Dpy19l4 A G 4: 11,296,034 S212P probably damaging Het
Ephb6 T C 6: 41,616,106 F426S probably damaging Het
F5 A T 1: 164,198,833 D1658V probably benign Het
Faah A T 4: 115,999,558 V469E probably damaging Het
Fas T C 19: 34,316,613 C123R probably damaging Het
Fhod1 T C 8: 105,338,914 probably benign Het
Filip1 A G 9: 79,898,307 V55A probably benign Het
Frmpd1 G A 4: 45,273,197 R372Q probably damaging Het
Glyctk C T 9: 106,157,607 G87S probably damaging Het
Gm4737 T C 16: 46,153,848 K389E probably benign Het
Gm5096 T G 18: 87,757,258 F302V probably damaging Het
Golga3 T C 5: 110,209,878 L1080P probably damaging Het
Gpr137 T C 19: 6,938,444 T281A probably benign Het
Grap2 T A 15: 80,648,411 probably null Het
Hlcs T C 16: 94,268,292 D170G probably damaging Het
Hook1 A G 4: 96,013,256 T484A probably benign Het
Hoxa5 T A 6: 52,203,791 H187L probably benign Het
Inpp1 G T 1: 52,790,094 S255R probably benign Het
Inpp4b T A 8: 81,768,157 V67E probably damaging Het
Iqgap3 A G 3: 88,087,309 N105S probably damaging Het
Kcnq5 A G 1: 21,469,468 probably null Het
Klhl1 T C 14: 96,240,213 N473S probably benign Het
Klk1b24 C A 7: 44,191,361 T71N probably benign Het
Loxhd1 A G 18: 77,380,573 probably null Het
Lrp1b C T 2: 41,111,059 R2165Q probably benign Het
Lrp2bp A T 8: 46,025,235 Q328L possibly damaging Het
Lrrc63 T A 14: 75,107,389 K419N possibly damaging Het
Lrrc9 A G 12: 72,500,759 N150S probably benign Het
Lrrn4 C A 2: 132,872,075 C317F probably damaging Het
Ltbp2 T C 12: 84,813,300 S627G probably damaging Het
Macf1 A T 4: 123,493,154 S1224T probably damaging Het
Meis2 A C 2: 116,058,670 H200Q probably benign Het
Mesd C A 7: 83,895,582 A80E probably benign Het
Mtor G T 4: 148,525,993 probably benign Het
Myo3a T C 2: 22,577,927 F398L probably benign Het
Nagpa G T 16: 5,201,528 probably benign Het
Nanp A G 2: 151,030,829 C60R probably benign Het
Nectin2 T G 7: 19,730,116 M313L probably benign Het
Nek4 C T 14: 30,956,887 H123Y probably damaging Het
Nploc4 A G 11: 120,408,781 V371A probably damaging Het
Ntrk3 T C 7: 78,356,014 probably benign Het
Olfr1463 T A 19: 13,234,901 V217E possibly damaging Het
Olfr156 A G 4: 43,820,723 F213L probably benign Het
Olfr658 T C 7: 104,644,946 N140S probably benign Het
Olfr740 A G 14: 50,453,177 T42A possibly damaging Het
Pcdh20 T A 14: 88,469,237 Q209L probably benign Het
Pcdhb20 G A 18: 37,504,697 R92H probably damaging Het
Pgap1 T C 1: 54,528,555 H377R probably benign Het
Phyhipl G T 10: 70,570,968 P52Q probably damaging Het
Plekhg4 T C 8: 105,381,040 probably benign Het
Pwwp2a T A 11: 43,705,556 V516E possibly damaging Het
Rack1 T C 11: 48,801,759 V69A probably damaging Het
Rexo5 T A 7: 119,801,358 probably null Het
Rnf123 T C 9: 108,071,466 probably benign Het
Rock1 G T 18: 10,072,863 Q1161K possibly damaging Het
Rps6ka2 T C 17: 7,292,867 L568P probably damaging Het
Seh1l T C 18: 67,783,984 S78P probably damaging Het
Serpinb3b A T 1: 107,155,843 probably null Het
Setd1a T C 7: 127,788,340 probably benign Het
Setx G T 2: 29,140,389 probably null Het
Sh3bp1 T C 15: 78,907,345 probably benign Het
Shc2 G T 10: 79,631,302 R146S probably damaging Het
Skap2 T C 6: 51,909,368 T5A probably benign Het
Skor2 A T 18: 76,876,645 probably benign Het
Slc35a3 T C 3: 116,687,334 I93M probably benign Het
Sohlh1 C T 2: 25,843,347 G295D probably damaging Het
Speg A G 1: 75,428,484 probably benign Het
Sult2a8 A C 7: 14,416,283 C168G probably benign Het
Tax1bp1 T C 6: 52,727,194 probably benign Het
Tbc1d4 T C 14: 101,447,688 I1176V possibly damaging Het
Tcof1 A G 18: 60,818,954 probably benign Het
Thada A T 17: 84,436,676 F735I possibly damaging Het
Tle1 A C 4: 72,139,831 H52Q probably damaging Het
Tmem101 A T 11: 102,153,329 V244E probably damaging Het
Tnfrsf26 C A 7: 143,617,931 C95F probably damaging Het
Uspl1 T C 5: 149,214,032 S482P probably benign Het
Vmn2r118 G T 17: 55,610,935 N192K probably benign Het
Vmn2r14 C T 5: 109,220,329 V266I possibly damaging Het
Vmn2r51 A G 7: 10,100,322 I263T probably damaging Het
Zfp937 T A 2: 150,239,047 C332* probably null Het
Zscan21 T A 5: 138,125,208 S50T probably benign Het
Other mutations in Ass1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Ass1 APN 2 31476922 missense probably damaging 1.00
IGL02152:Ass1 APN 2 31492324 missense probably damaging 1.00
R0008:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0083:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0084:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0085:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0087:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0183:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0220:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0254:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0302:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0346:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0440:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0472:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0605:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0644:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R1460:Ass1 UTSW 2 31514741 missense probably benign 0.37
R1465:Ass1 UTSW 2 31520416 makesense probably null
R1770:Ass1 UTSW 2 31486516 missense probably benign 0.29
R1908:Ass1 UTSW 2 31493148 nonsense probably null
R2361:Ass1 UTSW 2 31520382 missense probably benign 0.02
R2430:Ass1 UTSW 2 31501496 missense probably damaging 1.00
R3816:Ass1 UTSW 2 31510105 splice site probably benign
R4614:Ass1 UTSW 2 31514783 missense probably damaging 1.00
R4628:Ass1 UTSW 2 31480988 missense probably damaging 1.00
R5007:Ass1 UTSW 2 31501532 missense possibly damaging 0.90
R5069:Ass1 UTSW 2 31510173 missense probably damaging 1.00
R5081:Ass1 UTSW 2 31488653 critical splice donor site probably null
R5315:Ass1 UTSW 2 31492329 missense probably benign 0.21
R5370:Ass1 UTSW 2 31518733 missense possibly damaging 0.56
R6259:Ass1 UTSW 2 31488642 missense possibly damaging 0.80
R6541:Ass1 UTSW 2 31510233 missense probably damaging 0.99
R6731:Ass1 UTSW 2 31514784 missense probably damaging 1.00
R6927:Ass1 UTSW 2 31514801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCCTGATTGGAGGAGCCAGGGG -3'
(R):5'- CTAGGCATGAGCACACAGGCAC -3'

Sequencing Primer
(F):5'- GGACTGAAGAAAAAGACAACTTCAC -3'
(R):5'- CCTTGGATGACCACTTTTGTAG -3'
Posted On2014-05-23