Incidental Mutation 'R1466:Glcci1'
ID201170
Institutional Source Beutler Lab
Gene Symbol Glcci1
Ensembl Gene ENSMUSG00000029638
Gene Nameglucocorticoid induced transcript 1
SynonymsFam117c, GIG18, Tssn1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R1466 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location8509600-8597548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8537964 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 6 (T6I)
Ref Sequence ENSEMBL: ENSMUSP00000124595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064285] [ENSMUST00000161217] [ENSMUST00000161494] [ENSMUST00000162383] [ENSMUST00000162564] [ENSMUST00000162567]
Predicted Effect probably damaging
Transcript: ENSMUST00000064285
AA Change: T194I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069444
Gene: ENSMUSG00000029638
AA Change: T194I

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 22 48 N/A INTRINSIC
low complexity region 69 110 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
Pfam:FAM117 159 468 1.7e-132 PFAM
low complexity region 493 506 N/A INTRINSIC
low complexity region 512 525 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161217
AA Change: T6I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124167
Gene: ENSMUSG00000029638
AA Change: T6I

DomainStartEndE-ValueType
Pfam:FAM117 1 284 3.2e-104 PFAM
low complexity region 305 318 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161494
AA Change: T6I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124595
Gene: ENSMUSG00000029638
AA Change: T6I

DomainStartEndE-ValueType
Pfam:FAM117 1 237 1e-83 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000162383
AA Change: T6I

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125260
Gene: ENSMUSG00000029638
AA Change: T6I

DomainStartEndE-ValueType
Pfam:FAM117 1 94 3.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162564
Predicted Effect probably damaging
Transcript: ENSMUST00000162567
AA Change: T6I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125079
Gene: ENSMUSG00000029638
AA Change: T6I

DomainStartEndE-ValueType
Pfam:FAM117 1 285 2.7e-100 PFAM
low complexity region 306 319 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
Meta Mutation Damage Score 0.494 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of unknown function. Expression of this gene is induced by glucocorticoids and may be an early marker for glucocorticoid-induced apoptosis. Single nucleotide polymorphisms in this gene are associated with a decreased response to inhaled glucocorticoids in asthmatic patients. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 134 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110012J17Rik T A 17: 66,380,435 D492V probably damaging Het
Abca13 T C 11: 9,570,536 probably benign Het
Abcg8 G C 17: 84,686,727 probably benign Het
Abhd15 C T 11: 77,515,410 A71V probably damaging Het
AC167973.1 A T 9: 43,265,352 noncoding transcript Het
Adamts12 T C 15: 11,311,359 F1234S probably benign Het
Ahnak A G 19: 9,015,875 D4841G probably damaging Het
Akap13 T C 7: 75,729,049 S2095P possibly damaging Het
Ampd2 T C 3: 108,080,337 probably null Het
Arhgef17 G T 7: 100,929,659 P694Q possibly damaging Het
Arrdc1 T C 2: 24,925,795 I398V probably benign Het
Ash1l T C 3: 89,052,065 Y2250H probably damaging Het
Aspg A G 12: 112,121,852 N385D probably benign Het
Atxn3 G A 12: 101,926,499 R319C possibly damaging Het
BC005561 T A 5: 104,518,257 I215N probably damaging Het
Brca2 G A 5: 150,552,258 A2478T probably damaging Het
Btrc T A 19: 45,513,382 probably benign Het
C1s1 C T 6: 124,531,131 C633Y probably damaging Het
C8g C T 2: 25,500,216 A6T probably benign Het
Capza2 T C 6: 17,657,159 probably benign Het
Cbl A T 9: 44,154,244 V706E probably benign Het
Ccdc84 A T 9: 44,413,680 probably benign Het
Cfhr1 C T 1: 139,557,574 E45K probably benign Het
Chd7 G A 4: 8,840,561 probably null Het
Chek1 G T 9: 36,725,857 A2E probably damaging Het
Clcn2 G A 16: 20,712,552 probably benign Het
Cndp2 G A 18: 84,677,315 probably benign Het
Cntnap1 C A 11: 101,180,360 F366L probably damaging Het
Col5a1 G T 2: 28,003,846 probably benign Het
Corin C T 5: 72,302,790 probably null Het
Crb2 T C 2: 37,783,388 Y99H probably damaging Het
Csf3r T A 4: 126,031,932 probably benign Het
Ctdspl2 G A 2: 122,003,929 R332K probably benign Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cym G A 3: 107,213,458 T277I probably damaging Het
Cyp2d11 C T 15: 82,391,735 C215Y probably benign Het
Dido1 G A 2: 180,662,328 P1261L probably damaging Het
Dnah10 T A 5: 124,763,096 Y1265N probably benign Het
Dtx3l G A 16: 35,932,728 L503F probably damaging Het
Eda T A X: 100,392,392 probably benign Homo
Efhb A G 17: 53,437,178 F462L probably damaging Het
Enpep T A 3: 129,319,448 T203S probably damaging Het
Exd1 G A 2: 119,520,734 probably benign Het
Fam184b G A 5: 45,580,509 probably benign Het
Fam20b T C 1: 156,686,188 probably benign Het
Fat3 A C 9: 16,375,482 V915G probably damaging Het
Fbln7 A G 2: 128,877,429 T49A probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgf14 T A 14: 124,676,539 K60M probably benign Het
Galnt4 A G 10: 99,108,709 R99G probably benign Het
Gimap4 C A 6: 48,691,282 Q196K probably benign Het
Gm10110 A T 14: 89,898,075 noncoding transcript Het
Gm4884 A G 7: 41,043,128 K174E probably damaging Het
Gm6583 C T 5: 112,354,764 G358D probably benign Het
Grip2 A T 6: 91,788,443 D19E probably damaging Het
Grk4 T C 5: 34,694,750 S113P probably benign Het
Hectd3 G A 4: 116,996,566 E220K probably damaging Het
Helz2 G A 2: 181,236,297 P903S probably damaging Het
Hydin T A 8: 110,532,953 V2519E possibly damaging Het
Igf2r A T 17: 12,717,269 probably benign Het
Ints11 G A 4: 155,888,110 probably null Het
Kif1a A G 1: 93,054,929 W718R possibly damaging Het
Kif1b A T 4: 149,223,252 Y839N probably damaging Het
Kif20b T A 19: 34,950,599 V1047D probably benign Het
Klhl23 T C 2: 69,833,888 I527T probably damaging Het
Klra10 T A 6: 130,279,315 R125S probably damaging Het
Klra10 T C 6: 130,279,431 N87D probably damaging Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lcn4 G A 2: 26,668,576 P166L probably damaging Het
Letmd1 T A 15: 100,472,542 probably null Het
Lrrc27 A G 7: 139,230,308 probably benign Het
Map4k2 G T 19: 6,341,917 W87L probably damaging Het
Mccc1 A G 3: 35,974,286 V457A probably benign Het
Mdn1 T A 4: 32,730,788 S2886T probably benign Het
Mgat4a A T 1: 37,464,406 probably benign Het
Mmp1b A T 9: 7,384,779 probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mrpl24 T A 3: 87,921,928 Y21* probably null Het
Mrps35 C T 6: 147,055,984 T169M probably damaging Het
Muc2 A G 7: 141,748,974 Y457C probably damaging Het
Muc4 G A 16: 32,753,595 G1157D probably benign Het
Myg1 T A 15: 102,337,390 L275Q probably damaging Het
Naga T A 15: 82,334,788 M237L probably null Het
Nek1 C T 8: 61,125,136 probably benign Het
Oc90 T A 15: 65,897,720 Y96F probably damaging Het
Olfr1029 T A 2: 85,975,995 F251I probably damaging Het
Olfr103 A T 17: 37,336,956 L92H probably benign Het
Olfr1253 C T 2: 89,752,267 C187Y probably damaging Het
Olfr46 A G 7: 140,610,969 I268V probably benign Het
Olfr522 A G 7: 140,162,203 V249A probably damaging Het
Orc4 A T 2: 48,909,494 C324S possibly damaging Het
Pald1 T C 10: 61,348,525 probably benign Het
Paox A G 7: 140,129,281 probably benign Het
Pcdh10 T G 3: 45,379,974 L241R probably damaging Het
Pdzrn4 T C 15: 92,770,537 S857P probably benign Het
Plec C T 15: 76,185,908 E1000K possibly damaging Het
Plvap A T 8: 71,508,481 V149D probably benign Het
Ppef1 C A X: 160,625,674 probably null Homo
Prkaa1 C A 15: 5,178,798 P507T probably benign Het
Psmd2 A G 16: 20,657,965 probably benign Het
Ptch1 A G 13: 63,524,969 Y804H probably benign Het
R3hdm2 A G 10: 127,476,690 I434V probably benign Het
Rbm28 G A 6: 29,155,017 probably benign Het
Rfx5 T A 3: 94,956,303 Y88N probably damaging Het
Rnase2b A T 14: 51,162,839 K126* probably null Het
Rpl3l A G 17: 24,730,871 I15V probably benign Het
Saal1 G T 7: 46,702,545 probably null Het
Sbpl A C 17: 23,953,254 D230E unknown Het
Scn10a T C 9: 119,666,490 Y322C probably damaging Het
Sec16a A T 2: 26,431,157 Y1308N probably damaging Het
Sis A T 3: 72,932,060 D824E possibly damaging Het
Slc25a36 A G 9: 97,080,355 F194L probably damaging Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc7a11 G T 3: 50,381,073 probably null Het
Slco4c1 A T 1: 96,841,172 S322T probably damaging Het
Smarcc2 A T 10: 128,474,245 T376S probably damaging Het
Srebf1 C T 11: 60,200,702 R999H probably benign Het
St3gal3 A C 4: 118,107,662 M1R probably null Het
Syp A T X: 7,648,705 probably benign Homo
Tas1r2 A G 4: 139,669,411 D687G probably damaging Het
Tekt4 A T 17: 25,472,074 Q118L probably benign Het
Tph2 T C 10: 115,079,695 N480S probably benign Het
Tsc2 A T 17: 24,608,973 M839K probably damaging Het
Ttc22 T C 4: 106,622,780 F77S probably damaging Het
Uaca C T 9: 60,854,321 A205V possibly damaging Het
Ubp1 T G 9: 113,944,835 probably benign Het
Uhmk1 A T 1: 170,208,653 probably null Het
Usp17lc A G 7: 103,418,941 H481R possibly damaging Het
Vwa3a A G 7: 120,768,165 Y181C probably damaging Het
Wdr26 C T 1: 181,185,934 probably benign Het
Wfikkn2 G A 11: 94,238,895 T140I probably damaging Het
Zfp704 G T 3: 9,447,348 T288N possibly damaging Het
Zfp93 T C 7: 24,276,096 V502A probably damaging Het
Zzef1 C T 11: 72,924,679 P2942S probably damaging Het
Other mutations in Glcci1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Glcci1 APN 6 8579596 missense probably damaging 0.99
IGL02349:Glcci1 APN 6 8558581 missense probably damaging 1.00
IGL02877:Glcci1 APN 6 8582757 missense probably damaging 1.00
IGL03291:Glcci1 APN 6 8579678 missense probably damaging 1.00
R1084:Glcci1 UTSW 6 8573221 nonsense probably null
R1289:Glcci1 UTSW 6 8593088 missense possibly damaging 0.70
R1466:Glcci1 UTSW 6 8537964 missense probably damaging 1.00
R1539:Glcci1 UTSW 6 8591620 missense probably damaging 1.00
R1584:Glcci1 UTSW 6 8537964 missense probably damaging 1.00
R1873:Glcci1 UTSW 6 8537837 missense probably benign 0.06
R1982:Glcci1 UTSW 6 8592980 missense probably damaging 1.00
R2043:Glcci1 UTSW 6 8582590 missense probably damaging 1.00
R2070:Glcci1 UTSW 6 8558566 missense probably damaging 1.00
R4834:Glcci1 UTSW 6 8582601 nonsense probably null
R5166:Glcci1 UTSW 6 8537854 missense probably benign 0.23
R5390:Glcci1 UTSW 6 8537835 missense probably benign 0.01
R6351:Glcci1 UTSW 6 8573203 nonsense probably null
X0065:Glcci1 UTSW 6 8591636 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCAGTTTGTGAGGCATGATGAAA -3'
(R):5'- TGTCTCCAAAATCATAATGCAGCCTGA -3'

Sequencing Primer
(F):5'- gggtatgtgaaaatcctcaagatg -3'
(R):5'- ATCATAATGCAGCCTGAACTTAC -3'
Posted On2014-05-23