Incidental Mutation 'R0005:BC037034'
ID201302
Institutional Source Beutler Lab
Gene Symbol BC037034
Ensembl Gene ENSMUSG00000036948
Gene NamecDNA sequence BC037034
Synonyms
MMRRC Submission 038301-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.316) question?
Stock #R0005 (G1)
Quality Score80
Status Validated
Chromosome5
Chromosomal Location138259656-138264033 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 138262654 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000048421] [ENSMUST00000062067] [ENSMUST00000100530] [ENSMUST00000159067] [ENSMUST00000159123] [ENSMUST00000159146] [ENSMUST00000159649] [ENSMUST00000161279] [ENSMUST00000161647]
Predicted Effect probably null
Transcript: ENSMUST00000048421
SMART Domains Protein: ENSMUSP00000046898
Gene: ENSMUSG00000036948

DomainStartEndE-ValueType
low complexity region 53 71 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 114 N/A INTRINSIC
low complexity region 215 225 N/A INTRINSIC
low complexity region 488 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062067
Predicted Effect probably benign
Transcript: ENSMUST00000100530
SMART Domains Protein: ENSMUSP00000098099
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 2 231 1.1e-57 PFAM
Pfam:Gal-3-0_sulfotr 270 463 1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144460
Predicted Effect probably benign
Transcript: ENSMUST00000159067
SMART Domains Protein: ENSMUSP00000125178
Gene: ENSMUSG00000106247

DomainStartEndE-ValueType
Pfam:Glypican 7 250 1e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159123
SMART Domains Protein: ENSMUSP00000137679
Gene: ENSMUSG00000036948

DomainStartEndE-ValueType
low complexity region 53 71 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159534
Predicted Effect probably null
Transcript: ENSMUST00000159649
SMART Domains Protein: ENSMUSP00000125208
Gene: ENSMUSG00000036948

DomainStartEndE-ValueType
low complexity region 219 233 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160157
Predicted Effect probably benign
Transcript: ENSMUST00000161279
SMART Domains Protein: ENSMUSP00000124841
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 2 231 1.1e-57 PFAM
Pfam:Gal-3-0_sulfotr 270 463 1e-54 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161604
SMART Domains Protein: ENSMUSP00000125441
Gene: ENSMUSG00000036948

DomainStartEndE-ValueType
low complexity region 219 233 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161647
SMART Domains Protein: ENSMUSP00000125084
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 4 226 5.3e-58 PFAM
Pfam:Gal-3-0_sulfotr 265 458 3.8e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162632
Predicted Effect probably null
Transcript: ENSMUST00000163268
SMART Domains Protein: ENSMUSP00000127072
Gene: ENSMUSG00000091964

DomainStartEndE-ValueType
low complexity region 219 233 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164203
SMART Domains Protein: ENSMUSP00000127440
Gene: ENSMUSG00000091964

DomainStartEndE-ValueType
low complexity region 53 71 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 114 N/A INTRINSIC
Pfam:DUF4707 139 579 4.7e-252 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167840
SMART Domains Protein: ENSMUSP00000132756
Gene: ENSMUSG00000091964

DomainStartEndE-ValueType
low complexity region 219 233 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170479
AA Change: *396W
Predicted Effect probably null
Transcript: ENSMUST00000171557
SMART Domains Protein: ENSMUSP00000128031
Gene: ENSMUSG00000091964

DomainStartEndE-ValueType
low complexity region 53 71 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 114 N/A INTRINSIC
Meta Mutation Damage Score 0.6156 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A G 7: 126,498,274 F201L probably damaging Het
Camsap3 T A 8: 3,604,288 F653I probably damaging Het
Col11a2 C T 17: 34,062,879 probably benign Het
Col27a1 A G 4: 63,225,400 T442A probably benign Het
Cpsf1 A G 15: 76,600,680 probably null Het
Enpp4 T C 17: 44,102,175 N156S probably benign Het
Fat3 T A 9: 15,962,866 N3485I probably damaging Het
Gabra2 C T 5: 70,973,436 V350I probably benign Het
Gm8909 G T 17: 36,162,192 probably benign Het
Hivep2 A G 10: 14,128,749 T364A probably damaging Het
Kif1b A T 4: 149,181,927 V402E probably damaging Het
Lamc3 A G 2: 31,922,428 D959G probably benign Het
Mag T A 7: 30,908,354 probably benign Het
Map3k1 A G 13: 111,755,704 F1006L probably benign Het
Mapre2 G A 18: 23,853,693 G54D probably damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myadm C T 7: 3,297,564 Q281* probably null Het
Mylk3 A T 8: 85,327,203 V625D possibly damaging Het
Nlrp9a T C 7: 26,573,788 probably benign Het
Olfr974 A G 9: 39,942,956 D232G probably benign Het
Plcz1 T A 6: 140,040,564 probably benign Het
Plekhg5 TCCCCC TCC 4: 152,112,651 probably benign Het
Plekhh2 A C 17: 84,586,433 D892A probably benign Het
Ppih A G 4: 119,318,601 probably benign Het
Pramef12 G T 4: 144,395,853 F40L probably damaging Het
Rtn4ip1 A T 10: 43,932,478 M84L probably benign Het
Slc35f4 G A 14: 49,322,486 probably benign Het
Spocd1 G T 4: 129,956,778 D866Y possibly damaging Het
Stxbp4 C T 11: 90,548,917 R365Q possibly damaging Het
Tmed4 C T 11: 6,271,781 R185H probably damaging Het
Tmem2 A G 19: 21,812,220 T595A probably damaging Het
Tnfsf9 T C 17: 57,107,236 V221A possibly damaging Het
Vsx2 C A 12: 84,570,241 P100Q possibly damaging Het
Wdr48 T A 9: 119,909,434 D53E probably benign Het
Zfp335 T A 2: 164,909,302 S115C possibly damaging Het
Zfp608 G A 18: 54,895,520 P1274S possibly damaging Het
Other mutations in BC037034
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:BC037034 APN 5 138261705 missense possibly damaging 0.46
IGL01617:BC037034 APN 5 138262216 missense probably damaging 1.00
IGL02256:BC037034 APN 5 138260315 missense probably damaging 0.99
IGL02493:BC037034 APN 5 138263170 unclassified probably null
IGL02904:BC037034 APN 5 138260602 missense probably benign 0.04
IGL03151:BC037034 APN 5 138262672 missense possibly damaging 0.95
R0010:BC037034 UTSW 5 138260293 unclassified probably null
R0010:BC037034 UTSW 5 138260293 unclassified probably null
R0619:BC037034 UTSW 5 138263826 unclassified probably benign
R0630:BC037034 UTSW 5 138262289 missense probably damaging 0.98
R1579:BC037034 UTSW 5 138261866 missense probably benign 0.00
R1778:BC037034 UTSW 5 138262477 unclassified probably null
R1816:BC037034 UTSW 5 138260341 missense possibly damaging 0.91
R2009:BC037034 UTSW 5 138260929 missense probably damaging 1.00
R4711:BC037034 UTSW 5 138262905 unclassified probably benign
R4923:BC037034 UTSW 5 138262379 unclassified probably benign
R4999:BC037034 UTSW 5 138261622 missense probably damaging 1.00
R5103:BC037034 UTSW 5 138262300 missense probably benign 0.15
R5221:BC037034 UTSW 5 138262240 missense probably benign 0.14
R5444:BC037034 UTSW 5 138260998 unclassified probably null
R5720:BC037034 UTSW 5 138263702 missense probably benign 0.00
R6519:BC037034 UTSW 5 138261848 missense probably damaging 0.99
R6599:BC037034 UTSW 5 138263458 unclassified probably null
R6918:BC037034 UTSW 5 138260664 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATTGTCCACCAGCAGCACAGAG -3'
(R):5'- AGTCAGAGATCAAGGCTACCTGCG -3'

Sequencing Primer
(F):5'- CCATCAGGCATGACAGGTAG -3'
(R):5'- GCTACAGACTCGATCTCCTGG -3'
Posted On2014-05-28