Incidental Mutation 'R0005:Myadm'
ID201303
Institutional Source Beutler Lab
Gene Symbol Myadm
Ensembl Gene ENSMUSG00000068566
Gene Namemyeloid-associated differentiation marker
SynonymsD7Wsu62e
MMRRC Submission 038301-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R0005 (G1)
Quality Score52
Status Validated
Chromosome7
Chromosomal Location3289080-3300442 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 3297564 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 281 (Q281*)
Ref Sequence ENSEMBL: ENSMUSP00000145120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096744] [ENSMUST00000164553] [ENSMUST00000203328] [ENSMUST00000203566] [ENSMUST00000204541]
Predicted Effect probably null
Transcript: ENSMUST00000096744
AA Change: Q281*
SMART Domains Protein: ENSMUSP00000094505
Gene: ENSMUSG00000068566
AA Change: Q281*

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:MARVEL 25 151 7.2e-16 PFAM
Pfam:MARVEL 162 311 1.6e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164553
AA Change: Q281*
SMART Domains Protein: ENSMUSP00000131318
Gene: ENSMUSG00000068566
AA Change: Q281*

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:MARVEL 25 151 5.6e-16 PFAM
Pfam:MARVEL 162 311 1.3e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203328
AA Change: Q281*
SMART Domains Protein: ENSMUSP00000144984
Gene: ENSMUSG00000068566
AA Change: Q281*

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:MARVEL 25 151 5.6e-16 PFAM
Pfam:MARVEL 162 311 1.3e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203566
AA Change: Q281*
SMART Domains Protein: ENSMUSP00000145120
Gene: ENSMUSG00000068566
AA Change: Q281*

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:MARVEL 25 151 5.6e-16 PFAM
Pfam:MARVEL 162 311 1.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203600
Predicted Effect probably benign
Transcript: ENSMUST00000204541
SMART Domains Protein: ENSMUSP00000145426
Gene: ENSMUSG00000068566

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:MARVEL 25 81 4.3e-9 PFAM
Meta Mutation Damage Score 0.6068 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A G 7: 126,498,274 F201L probably damaging Het
BC037034 T C 5: 138,262,654 probably null Het
Camsap3 T A 8: 3,604,288 F653I probably damaging Het
Col11a2 C T 17: 34,062,879 probably benign Het
Col27a1 A G 4: 63,225,400 T442A probably benign Het
Cpsf1 A G 15: 76,600,680 probably null Het
Enpp4 T C 17: 44,102,175 N156S probably benign Het
Fat3 T A 9: 15,962,866 N3485I probably damaging Het
Gabra2 C T 5: 70,973,436 V350I probably benign Het
Gm8909 G T 17: 36,162,192 probably benign Het
Hivep2 A G 10: 14,128,749 T364A probably damaging Het
Kif1b A T 4: 149,181,927 V402E probably damaging Het
Lamc3 A G 2: 31,922,428 D959G probably benign Het
Mag T A 7: 30,908,354 probably benign Het
Map3k1 A G 13: 111,755,704 F1006L probably benign Het
Mapre2 G A 18: 23,853,693 G54D probably damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mylk3 A T 8: 85,327,203 V625D possibly damaging Het
Nlrp9a T C 7: 26,573,788 probably benign Het
Olfr974 A G 9: 39,942,956 D232G probably benign Het
Plcz1 T A 6: 140,040,564 probably benign Het
Plekhg5 TCCCCC TCC 4: 152,112,651 probably benign Het
Plekhh2 A C 17: 84,586,433 D892A probably benign Het
Ppih A G 4: 119,318,601 probably benign Het
Pramef12 G T 4: 144,395,853 F40L probably damaging Het
Rtn4ip1 A T 10: 43,932,478 M84L probably benign Het
Slc35f4 G A 14: 49,322,486 probably benign Het
Spocd1 G T 4: 129,956,778 D866Y possibly damaging Het
Stxbp4 C T 11: 90,548,917 R365Q possibly damaging Het
Tmed4 C T 11: 6,271,781 R185H probably damaging Het
Tmem2 A G 19: 21,812,220 T595A probably damaging Het
Tnfsf9 T C 17: 57,107,236 V221A possibly damaging Het
Vsx2 C A 12: 84,570,241 P100Q possibly damaging Het
Wdr48 T A 9: 119,909,434 D53E probably benign Het
Zfp335 T A 2: 164,909,302 S115C possibly damaging Het
Zfp608 G A 18: 54,895,520 P1274S possibly damaging Het
Other mutations in Myadm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Myadm APN 7 3297223 missense possibly damaging 0.79
IGL01075:Myadm APN 7 3297246 missense probably damaging 1.00
IGL03342:Myadm APN 7 3296887 missense possibly damaging 0.93
R0269:Myadm UTSW 7 3296757 missense unknown
R0413:Myadm UTSW 7 3296760 frame shift probably null
R0414:Myadm UTSW 7 3296760 frame shift probably null
R0666:Myadm UTSW 7 3297349 missense probably damaging 0.98
R3036:Myadm UTSW 7 3297543 missense probably benign
R4275:Myadm UTSW 7 3297102 missense probably benign 0.01
R4606:Myadm UTSW 7 3297400 nonsense probably null
R5764:Myadm UTSW 7 3297252 missense possibly damaging 0.93
R6558:Myadm UTSW 7 3297061 missense probably damaging 1.00
R6835:Myadm UTSW 7 3297676 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GGCAGTCTATGCCATCTGCTTCATAC -3'
(R):5'- GCCCCTAAAGAGACCCTTGGAGTAAAG -3'

Sequencing Primer
(F):5'- CATCTGCTTCATACTAGCAGGGG -3'
(R):5'- CAAGATTTCTTAGGGCTCCCAAG -3'
Posted On2014-05-28