Mutagenetix > Incidental Mutation

Incidental Mutation 'R0019:Fshb'

201343

Institutional Source

Beutler Lab

Gene Symbol

Fshb

Ensembl Gene

ENSMUSG00000027120

Gene Name

follicle stimulating hormone beta

Synonyms

Fshbeta, FSH

MMRRC Submission

038314-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R0019 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

106886485-106890001 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106887690 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 110 (S110G)

Ref Sequence

ENSEMBL: ENSMUSP00000028533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028533]

AlphaFold

Q60687

Predicted Effect

probably benign
Transcript: ENSMUST00000028533
AA Change: S110G

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000028533
Gene: ENSMUSG00000027120
AA Change: S110G

Domain	Start	End	E-Value	Type
GHB	18	124	7.2e-67	SMART

Meta Mutation Damage Score

0.1602

Coding Region Coverage

1x: 99.3%
3x: 98.9%
10x: 97.7%
20x: 96.0%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: The pituitary glycoprotein hormone family includes follicle-stimulating hormone, luteinizing hormone, chorionic gonadotropin, and thyroid-stimulating hormone. All of these glycoproteins consist of an identical alpha subunit and a hormone-specific beta subunit. This gene encodes the beta subunit of follicle-stimulating hormone. In conjunction with luteinizing hormone, follicle-stimulating hormone induces egg and sperm production. [provided by RefSeq, Aug 2015]
PHENOTYPE: Females homozygous for a targeted null mutation are sterile with a preantral block in folliculogenesis. Mutant males have small testes and reduced Sertoli and germ cell numbers, but are fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl1	T	A	8: 46,974,287 (GRCm39)		probably null	Het
Ankrd13a	T	A	5: 114,924,142 (GRCm39)		probably benign	Het
D130043K22Rik	T	A	13: 25,064,795 (GRCm39)	V737D	probably damaging	Het
Dhx37	C	A	5: 125,507,098 (GRCm39)	G133C	probably benign	Het
Espl1	A	C	15: 102,214,754 (GRCm39)	Q765P	probably null	Het
Fasn	A	T	11: 120,698,824 (GRCm39)		probably benign	Het
Gsap	T	C	5: 21,475,620 (GRCm39)		probably benign	Het
Helz2	C	A	2: 180,874,552 (GRCm39)	G1981C	probably damaging	Het
Herc3	T	C	6: 58,862,050 (GRCm39)		probably benign	Het
Il1r2	C	T	1: 40,164,210 (GRCm39)	T359M	probably damaging	Het
Lrig1	T	A	6: 94,584,330 (GRCm39)	R905*	probably null	Het
Myh7	T	A	14: 55,221,191 (GRCm39)	N911Y	possibly damaging	Het
Nfatc1	C	A	18: 80,678,719 (GRCm39)	V890L	probably benign	Het
Pcolce2	A	G	9: 95,577,017 (GRCm39)		probably null	Het
Pdcl	A	T	2: 37,241,932 (GRCm39)	L273M	probably damaging	Het
Pycr3	A	G	15: 75,791,155 (GRCm39)		probably benign	Het
Rlf	A	G	4: 121,003,769 (GRCm39)	V1737A	possibly damaging	Het
Sstr1	T	C	12: 58,259,935 (GRCm39)	L186S	probably damaging	Het
Trim69	A	T	2: 122,004,958 (GRCm39)		probably null	Het
Trim80	T	G	11: 115,338,768 (GRCm39)	Y533D	probably damaging	Het
Unc13b	T	C	4: 43,096,990 (GRCm39)	I121T	possibly damaging	Het
Vinac1	G	T	2: 128,880,946 (GRCm39)	H327N	probably benign	Het
Ywhab	T	A	2: 163,858,090 (GRCm39)	I219N	probably damaging	Het
Zfp560	G	A	9: 20,259,656 (GRCm39)	S402L	probably benign	Het
Zfp943	C	T	17: 22,211,070 (GRCm39)		probably benign	Het

Other mutations in Fshb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01918:Fshb	APN	2	106,889,272 (GRCm39)	missense	probably benign	0.00
IGL01985:Fshb	APN	2	106,889,173 (GRCm39)	missense	probably benign	0.00
IGL02756:Fshb	APN	2	106,889,218 (GRCm39)	missense	probably damaging	1.00
IGL03083:Fshb	APN	2	106,887,812 (GRCm39)	missense	probably benign	0.00
R0019:Fshb	UTSW	2	106,887,690 (GRCm39)	missense	probably benign	0.22
R4754:Fshb	UTSW	2	106,887,627 (GRCm39)	makesense	probably null
R5197:Fshb	UTSW	2	106,887,854 (GRCm39)	missense	possibly damaging	0.85
R5319:Fshb	UTSW	2	106,889,224 (GRCm39)	missense	probably damaging	0.99
R6173:Fshb	UTSW	2	106,887,638 (GRCm39)	missense	possibly damaging	0.66
R9531:Fshb	UTSW	2	106,887,692 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTCTGATGGCTCTAAAAGGCAGACG -3'
(R):5'- TCTGGTGTATAAGGACCCAGCTCG -3'

Sequencing Primer
(F):5'- TATCTGTCAGGACAGCGGAC -3'
(R):5'- GGCCCAATACCCAGAAAGTATG -3'

Posted On

2014-06-02