Incidental Mutation 'R0019:Zfp943'
ID201358
Institutional Source Beutler Lab
Gene Symbol Zfp943
Ensembl Gene ENSMUSG00000053347
Gene Namezinc finger prtoein 943
Synonyms
MMRRC Submission 038314-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R0019 (G1)
Quality Score47
Status Validated
Chromosome17
Chromosomal Location21962552-22071168 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 21992089 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055349] [ENSMUST00000153985] [ENSMUST00000174015]
Predicted Effect probably benign
Transcript: ENSMUST00000055349
SMART Domains Protein: ENSMUSP00000059554
Gene: ENSMUSG00000053347

DomainStartEndE-ValueType
KRAB 13 72 2.62e-18 SMART
ZnF_C2H2 180 202 1.6e-4 SMART
ZnF_C2H2 208 230 1.38e-3 SMART
ZnF_C2H2 236 258 1.13e-4 SMART
ZnF_C2H2 264 286 1.03e-2 SMART
ZnF_C2H2 292 314 2.24e-3 SMART
ZnF_C2H2 320 342 9.58e-3 SMART
ZnF_C2H2 348 370 5.67e-5 SMART
ZnF_C2H2 376 398 4.54e-4 SMART
ZnF_C2H2 404 426 2.15e-5 SMART
ZnF_C2H2 432 454 5.59e-4 SMART
ZnF_C2H2 460 482 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153985
SMART Domains Protein: ENSMUSP00000115817
Gene: ENSMUSG00000053347

DomainStartEndE-ValueType
KRAB 13 73 3.51e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174015
SMART Domains Protein: ENSMUSP00000133735
Gene: ENSMUSG00000053347

DomainStartEndE-ValueType
KRAB 13 60 3.79e-15 SMART
Meta Mutation Damage Score 0.1552 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T A 8: 46,521,250 probably null Het
Ankrd13a T A 5: 114,786,081 probably benign Het
D130043K22Rik T A 13: 24,880,812 V737D probably damaging Het
Dhx37 C A 5: 125,430,034 G133C probably benign Het
Espl1 A C 15: 102,306,319 Q765P probably null Het
Fasn A T 11: 120,807,998 probably benign Het
Fshb T C 2: 107,057,345 S110G probably benign Het
Gm14025 G T 2: 129,039,026 H327N probably benign Het
Gsap T C 5: 21,270,622 probably benign Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc3 T C 6: 58,885,065 probably benign Het
Il1r2 C T 1: 40,125,050 T359M probably damaging Het
Lrig1 T A 6: 94,607,349 R905* probably null Het
Myh7 T A 14: 54,983,734 N911Y possibly damaging Het
Nfatc1 C A 18: 80,635,504 V890L probably benign Het
Pcolce2 A G 9: 95,694,964 probably null Het
Pdcl A T 2: 37,351,920 L273M probably damaging Het
Pycrl A G 15: 75,919,306 probably benign Het
Rlf A G 4: 121,146,572 V1737A possibly damaging Het
Sstr1 T C 12: 58,213,149 L186S probably damaging Het
Trim69 A T 2: 122,174,477 probably null Het
Trim80 T G 11: 115,447,942 Y533D probably damaging Het
Unc13b T C 4: 43,096,990 I121T possibly damaging Het
Ywhab T A 2: 164,016,170 I219N probably damaging Het
Zfp560 G A 9: 20,348,360 S402L probably benign Het
Other mutations in Zfp943
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03101:Zfp943 APN 17 21992175 missense probably damaging 1.00
R0827:Zfp943 UTSW 17 21992090 critical splice acceptor site probably null
R1824:Zfp943 UTSW 17 21992380 missense probably benign 0.32
R1958:Zfp943 UTSW 17 21992998 missense probably damaging 0.99
R2174:Zfp943 UTSW 17 21992823 missense probably damaging 1.00
R3790:Zfp943 UTSW 17 21992422 missense possibly damaging 0.81
R4093:Zfp943 UTSW 17 21992982 missense probably damaging 1.00
R4094:Zfp943 UTSW 17 21992982 missense probably damaging 1.00
R4352:Zfp943 UTSW 17 21993123 missense probably damaging 0.98
R4677:Zfp943 UTSW 17 21993195 missense probably benign 0.17
R4735:Zfp943 UTSW 17 21992410 missense probably benign 0.03
R5201:Zfp943 UTSW 17 21992813 missense probably damaging 1.00
R5492:Zfp943 UTSW 17 21993075 missense probably damaging 1.00
R5642:Zfp943 UTSW 17 21992832 missense probably damaging 1.00
R6031:Zfp943 UTSW 17 21993376 missense probably benign
R6031:Zfp943 UTSW 17 21993376 missense probably benign
R6667:Zfp943 UTSW 17 21992908 missense probably damaging 1.00
R6864:Zfp943 UTSW 17 21992612 missense probably damaging 1.00
R6976:Zfp943 UTSW 17 21990941 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TCCACCCTTCTGCTAAGGAATGTGTTA -3'
(R):5'- TGTCAAAAGCCTTATCAAGCTCTGTGT -3'

Sequencing Primer
(F):5'- CCTCTCTTGAGATCTCTATCCTTGAG -3'
(R):5'- CTTTGGTGTTCATAGAACCATGTC -3'
Posted On2014-06-02