Incidental Mutation 'R0020:Cstb'
ID 201372
Institutional Source Beutler Lab
Gene Symbol Cstb
Ensembl Gene ENSMUSG00000005054
Gene Name cystatin B
Synonyms Stfb
MMRRC Submission 038315-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0020 (G1)
Quality Score 57
Status Validated
Chromosome 10
Chromosomal Location 78261504-78263456 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 78263170 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 65 (V65E)
Ref Sequence ENSEMBL: ENSMUSP00000005185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005185]
AlphaFold Q62426
Predicted Effect probably benign
Transcript: ENSMUST00000005185
AA Change: V65E

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000005185
Gene: ENSMUSG00000005054
AA Change: V65E

DomainStartEndE-ValueType
CY 1 98 2.04e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218544
Meta Mutation Damage Score 0.3858 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.4%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and kininogens. This gene encodes a stefin that functions as an intracellular thiol protease inhibitor. The protein is able to form a dimer stabilized by noncovalent forces, inhibiting papain and cathepsins l, h and b. The protein is thought to play a role in protecting against the proteases leaking from lysosomes. Evidence indicates that mutations in this gene are responsible for the primary defects in patients with progressive myoclonic epilepsy (EPM1). One type of mutation responsible for EPM1 is the expansion in the promoter region of this gene of a CCCCGCCCCGCG repeat from 2-3 copies to 30-78 copies. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null mutation provide a model for Unverricht-Lundborg disease (EPM1) by displaying progressive ataxia and myoclonic seizures. Notably, homozygous null mice exhibit apoptosis in cerebellar granule cells, implying that a similar mechanism of cell loss may occur in human EPM1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ado T C 10: 67,383,927 (GRCm39) D226G probably benign Het
Agfg2 C T 5: 137,652,064 (GRCm39) V432M probably benign Het
Atf2 T C 2: 73,676,628 (GRCm39) D122G possibly damaging Het
Brd10 A T 19: 29,693,597 (GRCm39) D2032E probably damaging Het
Cd2bp2 G A 7: 126,792,996 (GRCm39) T342M probably damaging Het
Cip2a A T 16: 48,821,975 (GRCm39) H201L probably damaging Het
Col6a3 T A 1: 90,739,272 (GRCm39) I319F probably damaging Het
Cst11 T A 2: 148,613,253 (GRCm39) Y24F probably damaging Het
Cyp2j11 G A 4: 96,195,641 (GRCm39) H352Y probably benign Het
D130043K22Rik T A 13: 25,038,475 (GRCm39) probably benign Het
Dbh A G 2: 27,060,584 (GRCm39) probably benign Het
Dhdh T C 7: 45,137,528 (GRCm39) K53R probably benign Het
Drc3 A G 11: 60,261,371 (GRCm39) Y174C probably damaging Het
Ezr G T 17: 7,010,126 (GRCm39) Q308K probably damaging Het
F3 A T 3: 121,525,265 (GRCm39) N169Y probably damaging Het
Fbn2 G T 18: 58,238,236 (GRCm39) T587K probably damaging Het
Fhl5 A T 4: 25,200,054 (GRCm39) V260E probably benign Het
Glyr1 A G 16: 4,854,913 (GRCm39) I55T probably damaging Het
Gm12695 G C 4: 96,657,972 (GRCm39) P66A probably damaging Het
Gon4l G T 3: 88,766,244 (GRCm39) V428L probably damaging Het
Ighv6-5 T C 12: 114,380,241 (GRCm39) D92G probably null Het
Inhba A C 13: 16,200,949 (GRCm39) K170N possibly damaging Het
Kng2 A G 16: 22,816,046 (GRCm39) V317A probably benign Het
Larp1 T A 11: 57,940,849 (GRCm39) D658E probably damaging Het
Map3k14 T C 11: 103,118,500 (GRCm39) E562G probably damaging Het
Megf10 G T 18: 57,420,965 (GRCm39) V868F possibly damaging Het
Nap1l1 A C 10: 111,326,884 (GRCm39) E148D probably benign Het
Nlrp4a A T 7: 26,149,797 (GRCm39) H468L probably damaging Het
Nphs1 G T 7: 30,162,633 (GRCm39) V357L probably benign Het
Or10aa3 T A 1: 173,878,413 (GRCm39) V158E probably damaging Het
Pclo A G 5: 14,719,687 (GRCm39) T1275A unknown Het
Pde4d T A 13: 110,091,104 (GRCm39) C35S possibly damaging Het
Pkd1l1 A G 11: 8,825,765 (GRCm39) probably benign Het
Pkd2 A G 5: 104,651,382 (GRCm39) E910G probably damaging Het
Pot1b T A 17: 55,960,429 (GRCm39) M634L probably benign Het
Ppp2r5c C T 12: 110,541,257 (GRCm39) Q469* probably null Het
Ppp6r2 T A 15: 89,143,342 (GRCm39) M163K probably damaging Het
Prss43 C A 9: 110,657,580 (GRCm39) probably benign Het
Rb1cc1 C A 1: 6,334,772 (GRCm39) N1444K possibly damaging Het
Rimoc1 T C 15: 4,021,350 (GRCm39) probably benign Het
Scube2 A G 7: 109,430,095 (GRCm39) probably benign Het
Slamf9 T C 1: 172,303,082 (GRCm39) S7P possibly damaging Het
Slc35b2 T A 17: 45,877,782 (GRCm39) M303K probably damaging Het
Slc4a7 T A 14: 14,796,108 (GRCm38) F1116I probably benign Het
Slco1a8 A T 6: 141,918,076 (GRCm39) V600E possibly damaging Het
Smarcad1 T A 6: 65,060,991 (GRCm39) probably benign Het
Tamalin T C 15: 101,128,433 (GRCm39) V157A probably damaging Het
Tns3 A C 11: 8,495,227 (GRCm39) probably null Het
Zfp282 T G 6: 47,856,943 (GRCm39) W59G probably damaging Het
Zfp746 C A 6: 48,041,641 (GRCm39) A362S probably benign Het
Other mutations in Cstb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Cstb APN 10 78,262,779 (GRCm39) missense probably benign 0.03
R0020:Cstb UTSW 10 78,263,170 (GRCm39) missense probably benign 0.07
R1867:Cstb UTSW 10 78,263,273 (GRCm39) makesense probably null
R3833:Cstb UTSW 10 78,263,184 (GRCm39) missense probably benign 0.13
R7378:Cstb UTSW 10 78,262,822 (GRCm39) missense probably damaging 1.00
R9406:Cstb UTSW 10 78,263,173 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AGAGCAGAGTGTCCTGCAACTTCC -3'
(R):5'- CGCAGTTTGAGAATCACAACAGAAGC -3'

Sequencing Primer
(F):5'- ACATGTTCTGAGAGGATGAATTTGG -3'
(R):5'- GAGAATCACAACAGAAGCTGCTC -3'
Posted On 2014-06-02