Incidental Mutation 'R0060:Suv39h2'
ID201396
Institutional Source Beutler Lab
Gene Symbol Suv39h2
Ensembl Gene ENSMUSG00000026646
Gene Namesuppressor of variegation 3-9 2
SynonymsSuv39h histone methyltransferase, 4930507K23Rik, D2Ertd544e, KMT1B
MMRRC Submission 038353-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0060 (G1)
Quality Score53
Status Validated
Chromosome2
Chromosomal Location3455815-3475031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3464916 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 134 (Y134C)
Ref Sequence ENSEMBL: ENSMUSP00000027956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027956] [ENSMUST00000060618] [ENSMUST00000061852] [ENSMUST00000100463] [ENSMUST00000115066] [ENSMUST00000127540]
Predicted Effect probably damaging
Transcript: ENSMUST00000027956
AA Change: Y134C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027956
Gene: ENSMUSG00000026646
AA Change: Y134C

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
CHROMO 117 169 2.44e-11 SMART
Pfam:Pre-SET 212 309 4.4e-18 PFAM
SET 317 446 4.05e-41 SMART
PostSET 461 477 7.05e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060618
SMART Domains Protein: ENSMUSP00000054169
Gene: ENSMUSG00000026646

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
SET 70 226 6.61e-23 SMART
PostSET 241 257 7.05e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061852
SMART Domains Protein: ENSMUSP00000054300
Gene: ENSMUSG00000026648

DomainStartEndE-ValueType
Lactamase_B 10 193 7.78e0 SMART
Pfam:DRMBL 239 345 1.6e-22 PFAM
low complexity region 383 400 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 593 601 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000100458
AA Change: Y31C
SMART Domains Protein: ENSMUSP00000098026
Gene: ENSMUSG00000026646
AA Change: Y31C

DomainStartEndE-ValueType
CHROMO 6 67 2e-7 SMART
Pfam:Pre-SET 110 207 1.3e-17 PFAM
SET 215 344 4.05e-41 SMART
PostSET 359 375 7.05e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100463
SMART Domains Protein: ENSMUSP00000098031
Gene: ENSMUSG00000026648

DomainStartEndE-ValueType
Lactamase_B 10 193 7.78e0 SMART
Pfam:DRMBL 239 345 6.5e-23 PFAM
low complexity region 476 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115066
SMART Domains Protein: ENSMUSP00000110718
Gene: ENSMUSG00000026648

DomainStartEndE-ValueType
Blast:Lactamase_B 25 70 1e-19 BLAST
Pfam:DRMBL 109 215 1.1e-22 PFAM
low complexity region 253 270 N/A INTRINSIC
low complexity region 333 347 N/A INTRINSIC
low complexity region 463 471 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000127540
AA Change: I85M
SMART Domains Protein: ENSMUSP00000125485
Gene: ENSMUSG00000026646
AA Change: I85M

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149932
Meta Mutation Damage Score 0.176 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (60/61)
MGI Phenotype PHENOTYPE: Less than 5% of mice either heterozygous or homozygous for a reporter/null allele develop late-onset B cell lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A C 11: 58,422,182 probably benign Het
A630091E08Rik A G 7: 98,543,668 noncoding transcript Het
Abca8a T C 11: 110,070,480 T539A probably damaging Het
Ankrd60 A T 2: 173,572,613 M1K probably null Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Cabcoco1 A T 10: 68,533,862 probably null Het
Capn7 T C 14: 31,365,604 probably benign Het
Cd109 G A 9: 78,703,107 E1145K probably damaging Het
Celsr1 A T 15: 85,922,198 V2353D probably damaging Het
Cep350 C T 1: 155,928,626 D904N probably damaging Het
Chl1 T A 6: 103,711,058 probably benign Het
Colec10 G A 15: 54,439,146 probably benign Het
Cst11 T A 2: 148,770,402 Q105L probably damaging Het
Eps8l3 T C 3: 107,879,541 L11S probably damaging Het
Gsdme A G 6: 50,221,029 I317T possibly damaging Het
Itgad T C 7: 128,202,986 S979P probably damaging Het
Mga T C 2: 119,960,961 probably null Het
Nubpl T C 12: 52,310,687 probably benign Het
Olfr1105 T C 2: 87,033,774 Y149C probably damaging Het
Olfr124 T C 17: 37,806,000 L285P probably damaging Het
Pard3b G A 1: 61,639,315 E25K probably damaging Het
Phactr1 T A 13: 42,682,721 Y8* probably null Het
Phf14 T C 6: 11,953,317 S352P probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prap1 G T 7: 140,093,477 probably benign Het
Prdm8 T A 5: 98,185,260 F229I probably benign Het
Rfx6 T C 10: 51,677,840 F11L probably benign Het
Rfx8 T A 1: 39,718,405 probably benign Het
Rif1 C T 2: 52,111,117 R1528C probably damaging Het
Ripk4 G A 16: 97,763,518 probably benign Het
Satb1 T A 17: 51,740,203 I695F probably damaging Het
Sema4d A G 13: 51,705,257 probably benign Het
Slc30a4 T A 2: 122,685,184 T381S probably benign Het
Tcerg1 C T 18: 42,524,008 A185V unknown Het
Tep1 T A 14: 50,866,029 D268V probably damaging Het
Tmem89 T A 9: 108,915,417 V126D probably damaging Het
Trf T C 9: 103,220,922 T46A probably benign Het
Trmt6 C T 2: 132,806,769 R415Q possibly damaging Het
Trp53bp1 T C 2: 121,204,525 K1625E probably damaging Het
Zcchc4 T A 5: 52,807,078 I292N possibly damaging Het
Other mutations in Suv39h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Suv39h2 APN 2 3464259 splice site probably benign
IGL03408:Suv39h2 APN 2 3459876 missense probably damaging 1.00
R0060:Suv39h2 UTSW 2 3464916 missense probably damaging 1.00
R0511:Suv39h2 UTSW 2 3472579 missense probably damaging 0.99
R1892:Suv39h2 UTSW 2 3459768 missense probably damaging 1.00
R1919:Suv39h2 UTSW 2 3464316 missense probably damaging 1.00
R3888:Suv39h2 UTSW 2 3464808 missense probably benign 0.09
R5583:Suv39h2 UTSW 2 3474853 unclassified probably benign
R6770:Suv39h2 UTSW 2 3472551 missense possibly damaging 0.52
R6801:Suv39h2 UTSW 2 3464421 missense probably benign 0.16
X0062:Suv39h2 UTSW 2 3464785 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCCCTCCAAGTCAACAGTGTTTTC -3'
(R):5'- GGACCACCTGTTTCCATGACCAAG -3'

Sequencing Primer
(F):5'- GAGGTAATCTTGCCATCTCTGC -3'
(R):5'- ACAGTCATAGGTTTCAGTGCC -3'
Posted On2014-06-06